Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI34999
Trapped Gene
Zmat1 (ENSMUSG00000052676)
Vector Insertion
Chr X: 131543449 - 131559832
Public Clones IST14203B9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000622588 (ChrX:131559612..131559831 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATGGAGTCCTCGCTACCAG ChrX:131559775..131559794 59.83 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000622588 (ChrX:131559612..131559831 -)
Downstram Exon
ENSMUSE00000713156 (ChrX:131543450..131543748 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATGGAGTCCTCGCTACCAG ChrX:131559775..131559794 59.83 60 AGGCGACAGCTTAGGGAACT ChrX:131543619..131543638 60.4 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000622588 ChrX:131559612..131559831 GATGGAGTCCTCGCTACCAG ChrX:131559775..131559794 59.83 60
upstream ENSMUSE00000712077 ChrX:131543450..131543748 AAGTAGACACCTGCCCTTGC ChrX:131543460..131543479 59.36 55
upstream ENSMUSE00000713156 ChrX:131543450..131543748 AAGTAGACACCTGCCCTTGC ChrX:131543460..131543479 59.36 55

*** Putative Vector Insertion (Chr X: 131543449 - 131559832) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000622582 ChrX:131528078..131528184 CGCAGGTTGTTCTTGTCCAT ChrX:131528131..131528150 61.1 50
downstream ENSMUSE00000622587 ChrX:131528078..131528184 CGCAGGTTGTTCTTGTCCAT ChrX:131528131..131528150 61.1 50
downstream ENSMUSE00000653695 ChrX:131526936..131527037 AGGCACTTCGCTTTGTTCTC ChrX:131526950..131526969 59.62 50
downstream ENSMUSE00000694696 ChrX:131526936..131527037 AGGCACTTCGCTTTGTTCTC ChrX:131526950..131526969 59.62 50
downstream ENSMUSE00000653694 ChrX:131526674..131526848 TGAGTCGGAGAATGGCTCTT ChrX:131526711..131526730 59.95 50
downstream ENSMUSE00000694695 ChrX:131526674..131526848 TGAGTCGGAGAATGGCTCTT ChrX:131526711..131526730 59.95 50
downstream ENSMUSE00000653693 ChrX:131525103..131525168 CAGACTTCAGGAAGGGTGGA ChrX:131525102..131525121 60.23 55
downstream ENSMUSE00000694694 ChrX:131525103..131525168 CAGACTTCAGGAAGGGTGGA ChrX:131525102..131525121 60.23 55
downstream ENSMUSE00000653688 ChrX:131512187..131512286 TGGGACCGGAACATATGTAAA ChrX:131512192..131512212 60.06 42.86
downstream ENSMUSE00000653691 ChrX:131512187..131512286 TGGGACCGGAACATATGTAAA ChrX:131512192..131512212 60.06 42.86
downstream ENSMUSE00000653690 ChrX:131509857..131509901 TACACTGCCAATGGGTCCAC ChrX:131509845..131509864 61.79 55
downstream ENSMUSE00000414494 ChrX:131508058..131508565 GCCCAGAAATTTTCAAGTGG ChrX:131508307..131508326 59.55 45
downstream ENSMUSE00000653686 ChrX:131507952..131508056 TGGGGAGGCACTGTATTCTT ChrX:131508012..131508031 59.55 50
downstream ENSMUSE00000546063 ChrX:131505914..131508565 CACTGGGGAGGCACTGTATT ChrX:131508009..131508028 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTATTCGTAATCGCCTTGCAG ChrX:131559767..131559788 60.23 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTCGCGTGACTGGGAAAAC ChrX:131559766..131559786 62.33 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052676