Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35001
Trapped Gene
Irak1 (ENSMUSG00000031392)
Vector Insertion
Chr X: 71263468 - 71265305
Public Clones IST14733C9 (tigm) IST14733C9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000209085 (ChrX:71265239..71265304 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGGACACAAGGTGCAAAG ChrX:71265251..71265270 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000209085 (ChrX:71265239..71265304 -)
Downstram Exon
ENSMUSE00000698958 (ChrX:71263469..71263705 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGGACACAAGGTGCAAAG ChrX:71265251..71265270 59.87 50 AGTAGGCTGGGTGCTTTTCA ChrX:71263621..71263640 59.88 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000699025 ChrX:71268949..71269084 TGTGCCGCTTCTACAAAGTG ChrX:71268986..71269005 60.05 50
upstream ENSMUSE00000699100 ChrX:71268949..71269254 TGTGCCGCTTCTACAAAGTG ChrX:71268986..71269005 60.05 50
upstream ENSMUSE00000707075 ChrX:71268949..71268985 No primer for this exon
upstream ENSMUSE00000707077 ChrX:71268949..71269168 TGTGCCGCTTCTACAAAGTG ChrX:71268986..71269005 60.05 50
upstream ENSMUSE00000209088 ChrX:71268705..71268872 CGTAGCTGACCTCGTTCACA ChrX:71268753..71268772 60.05 55
upstream ENSMUSE00000655127 ChrX:71268705..71269165 TGTGCCGCTTCTACAAAGTG ChrX:71268986..71269005 60.05 50
upstream ENSMUSE00000209095 ChrX:71268405..71268536 AGTCCTCTGCCTCCACCTTC ChrX:71268415..71268434 60.79 60
upstream ENSMUSE00000716770 ChrX:71268405..71268536 AGTCCTCTGCCTCCACCTTC ChrX:71268415..71268434 60.79 60
upstream ENSMUSE00000718812 ChrX:71268405..71268536 AGTCCTCTGCCTCCACCTTC ChrX:71268415..71268434 60.79 60
upstream ENSMUSE00000209091 ChrX:71268188..71268291 AGCTCCTCCAGGTTCCACTC ChrX:71268239..71268258 60.79 60
upstream ENSMUSE00000655125 ChrX:71268188..71268291 AGCTCCTCCAGGTTCCACTC ChrX:71268239..71268258 60.79 60
upstream ENSMUSE00000209086 ChrX:71267812..71268003 AGAGGGTGGTTTTGGATGTG ChrX:71267865..71267884 59.82 50
upstream ENSMUSE00000467857 ChrX:71267812..71268000 AGAGGGTGGTTTTGGATGTG ChrX:71267865..71267884 59.82 50
upstream ENSMUSE00000708417 ChrX:71267812..71268003 AGAGGGTGGTTTTGGATGTG ChrX:71267865..71267884 59.82 50
upstream ENSMUSE00000716599 ChrX:71267812..71268003 AGAGGGTGGTTTTGGATGTG ChrX:71267865..71267884 59.82 50
upstream ENSMUSE00000209098 ChrX:71267524..71267588 No primer for this exon
upstream ENSMUSE00000655123 ChrX:71267524..71267588 No primer for this exon
upstream ENSMUSE00000209087 ChrX:71267188..71267302 TTTATGGCTTCTTGCCCAAT ChrX:71267218..71267237 59.55 40
upstream ENSMUSE00000655122 ChrX:71266282..71266400 CAGGATAGCCCCAGCCTTAT ChrX:71266300..71266319 60.43 55
upstream ENSMUSE00000710909 ChrX:71266282..71266400 CAGGATAGCCCCAGCCTTAT ChrX:71266300..71266319 60.43 55
upstream ENSMUSE00000719840 ChrX:71266282..71266400 CAGGATAGCCCCAGCCTTAT ChrX:71266300..71266319 60.43 55
upstream ENSMUSE00000209097 ChrX:71265667..71265874 TGTGGACACCGATACCTTCA ChrX:71265678..71265697 59.96 50
upstream ENSMUSE00000709376 ChrX:71265667..71265874 TGTGGACACCGATACCTTCA ChrX:71265678..71265697 59.96 50
upstream ENSMUSE00000720282 ChrX:71265667..71265874 TGTGGACACCGATACCTTCA ChrX:71265678..71265697 59.96 50
upstream ENSMUSE00000209085 ChrX:71265239..71265304 TGAGGACACAAGGTGCAAAG ChrX:71265251..71265270 59.87 50
upstream ENSMUSE00000698965 ChrX:71265239..71265304 TGAGGACACAAGGTGCAAAG ChrX:71265251..71265270 59.87 50
upstream ENSMUSE00000209092 ChrX:71263469..71263705 GGCTCAACTAGCTTGCTGCT ChrX:71263510..71263529 59.93 55
upstream ENSMUSE00000698958 ChrX:71263469..71263705 GGCTCAACTAGCTTGCTGCT ChrX:71263510..71263529 59.93 55

*** Putative Vector Insertion (Chr X: 71263468 - 71265305) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000209100 ChrX:71263240..71263356 CAGAGCACCTCCCCAAATAG ChrX:71263277..71263296 59.69 55
downstream ENSMUSE00000655120 ChrX:71262469..71262769 CCGGGAACACTCTCATCACT ChrX:71262596..71262615 60.11 55
downstream ENSMUSE00000698956 ChrX:71262469..71262850 GGAATGCAGGGTAGCAGAGA ChrX:71262574..71262593 60.36 55
downstream ENSMUSE00000716884 ChrX:71262469..71262850 GGAATGCAGGGTAGCAGAGA ChrX:71262574..71262593 60.36 55
downstream ENSMUSE00000720852 ChrX:71262469..71262850 GGAATGCAGGGTAGCAGAGA ChrX:71262574..71262593 60.36 55
downstream ENSMUSE00000209096 ChrX:71261887..71262036 GTTGCAGGCTATCCAAGACC ChrX:71261889..71261908 59.7 55
downstream ENSMUSE00000698975 ChrX:71261887..71262036 GTTGCAGGCTATCCAAGACC ChrX:71261889..71261908 59.7 55
downstream ENSMUSE00000698997 ChrX:71261887..71262036 GTTGCAGGCTATCCAAGACC ChrX:71261889..71261908 59.7 55
downstream ENSMUSE00000699024 ChrX:71260779..71260840 CTTCAGGTCCCTGGCTCTTT ChrX:71260780..71260799 60.76 55
downstream ENSMUSE00000623481 ChrX:71260745..71260840 CTTCAGGTCCCTGGCTCTTT ChrX:71260780..71260799 60.76 55
downstream ENSMUSE00000571832 ChrX:71260145..71260840 TTTCGCTTGGTGTTTTAGGG ChrX:71260147..71260166 60.1 45
downstream ENSMUSE00000698972 ChrX:71260145..71260840 TTTCGCTTGGTGTTTTAGGG ChrX:71260147..71260166 60.1 45
downstream ENSMUSE00000698992 ChrX:71260145..71260840 TTTCGCTTGGTGTTTTAGGG ChrX:71260147..71260166 60.1 45
downstream ENSMUSE00000699034 ChrX:71259397..71259464 CCAATAGCATCAATATCCACGA ChrX:71259418..71259439 59.82 40.91
downstream ENSMUSE00000411779 ChrX:71259265..71259464 CCAAAACAAGTGGGGCTAAG ChrX:71259308..71259327 59.6 50
downstream ENSMUSE00000461739 ChrX:71259257..71260840 CCTCACATTGCCTGCCTTAT ChrX:71260538..71260557 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGGGCTGTGAGGACACAA ChrX:71265258..71265278 60.86 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGGGCTGTGAGGACACAA ChrX:71265258..71265278 60.86 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031392