Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35011
Trapped Gene
CAAA01179078.1.1.20098 (ENSMUSG00000053338)
Vector Insertion
Chr 7: 3489956 - 3496873
Public Clones IST14284D6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000422425 (Chr7:3496807..3496872 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GATCTTGCTGCCTCGACTTT Chr7:3496836..3496855 59.58 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000422425 (Chr7:3496807..3496872 -)
Downstram Exon
ENSMUSE00000422450 (Chr7:3489957..3490102 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GATCTTGCTGCCTCGACTTT Chr7:3496836..3496855 59.58 50 ACCGACCCGGATGAGATTAT Chr7:3490025..3490044 60.55 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633587 Chr7:3503313..3503433 GCTGAAGACCTTTGGACCAG Chr7:3503360..3503379 59.84 55
upstream ENSMUSE00000422442 Chr7:3499077..3499112 TGTTGGGCAAACAGACATTC Chr7:3499086..3499105 59.55 45
upstream ENSMUSE00000422437 Chr7:3498306..3498596 CAGAATGATGGCGGACACTA Chr7:3498383..3498402 59.67 50
upstream ENSMUSE00000422430 Chr7:3497556..3497852 ATCAGGCAAAGGCTCCCTAT Chr7:3497599..3497618 60.06 50
upstream ENSMUSE00000422425 Chr7:3496807..3496872 GATCTTGCTGCCTCGACTTT Chr7:3496836..3496855 59.58 50
upstream ENSMUSE00000422450 Chr7:3489957..3490102 GAGCGGCTGTCTCCAAATAA Chr7:3489970..3489989 60.35 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTCCTAATCGCCTTGCAG Chr7:3493808..3493828 61.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATGTGTGTGTTCCCGTGACT Chr7:3496815..3496835 58.86 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053338