Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35014
Trapped Gene
Lsm6 (ENSMUSG00000031683)
Vector Insertion
Chr 8: 81336874 - 81345040
Public Clones (sanger) IST14729E8 (tigm) IST13438E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682020 (Chr8:81344947..81345039 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682020 (Chr8:81344947..81345039 -)
Downstram Exon
ENSMUSE00000378551 (Chr8:81336875..81336979 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GAAGTCGCTAGGGGTTTGCT Chr8:81336914..81336933 60.76 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000682020 Chr8:81344947..81345039 No primer for this exon
upstream ENSMUSE00000378551 Chr8:81336875..81336979 GCAAACCCCTAGCGACTTCT Chr8:81336935..81336954 60.76 55

*** Putative Vector Insertion (Chr 8: 81336874 - 81345040) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000211722 Chr8:81333846..81333959 ATTGTTTCCTCGGATGAACG Chr8:81333825..81333844 59.93 45
downstream ENSMUSE00000381964 Chr8:81330350..81332144 TGTGCACACCATCAAACCTT Chr8:81330983..81331002 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATTGGGTGAGATGGGAAAG Chr8:81339026..81339046 59.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATTGGGTGAGATGGGAAAG Chr8:81339026..81339046 59.34 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031683