Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35032
Trapped Gene
Echdc3 (ENSMUSG00000039063)
Vector Insertion
Chr 2: 6116628 - 6127559
Public Clones IST12742A5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 44% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000701197 (Chr2:6127052..6127558 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCGTTTGGATTCCTAGCTT Chr2:6127189..6127208 59.85 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000701197 (Chr2:6127052..6127558 -)
Downstram Exon
ENSMUSE00000311980 (Chr2:6116629..6116829 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCGTTTGGATTCCTAGCTT Chr2:6127189..6127208 59.85 45 TTGTCACTTGCCACAGCAAT Chr2:6116692..6116711 60.31 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000331811 Chr2:6133837..6134040 TTGCACAGTCAACCTTGCTT Chr2:6134019..6134038 59.49 45
upstream ENSMUSE00000701198 Chr2:6133837..6134025 TTGCTTTTCTTGGCTGCAAT Chr2:6134005..6134024 60.89 40
upstream ENSMUSE00000311995 Chr2:6129514..6129635 CCGAAGTGACATTCTTCACG Chr2:6129553..6129572 59.29 50
upstream ENSMUSE00000311987 Chr2:6127461..6127558 GAGCTGACAGATGCACAAGG Chr2:6127501..6127520 59.58 55
upstream ENSMUSE00000701197 Chr2:6127052..6127558 TGCGTTTGGATTCCTAGCTT Chr2:6127189..6127208 59.85 45
upstream ENSMUSE00000311980 Chr2:6116629..6116829 ATTGCTGTGGCAAGTGACAA Chr2:6116714..6116733 60.31 45

*** Putative Vector Insertion (Chr 2: 6116628 - 6127559) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000362284 Chr2:6109511..6110697 AGGAAGCGACTCTCATTGGA Chr2:6109656..6109675 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTTGGATGGTTGGAATTATCAG Chr2:6121584..6121606 58.44 40.91 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTGGATGGTTGGAATTATCAG Chr2:6121584..6121606 58.44 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039063