Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35034
Trapped Gene
Csgalnact1 (ENSMUSG00000036356)
Vector Insertion
Chr 8: 71080870 - 71169835
Public Clones IST10322C9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000517997 (Chr8:71169698..71169834 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTCTGTGGCTGGAATCTTCA Chr8:71169735..71169754 59.37 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000517997 (Chr8:71169698..71169834 -)
Downstram Exon
ENSMUSE00000516393 (Chr8:71080871..71081019 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTCTGTGGCTGGAATCTTCA Chr8:71169735..71169754 59.37 45 TAGCACCGTGTTCAGCTCAG Chr8:71080970..71080989 60.2 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000515352 Chr8:71258925..71259034 CTCGCAGGAGGGAAAGTTCA Chr8:71258987..71259006 62.76 55
upstream ENSMUSE00000517997 Chr8:71169698..71169834 TTCTGTGGCTGGAATCTTCA Chr8:71169735..71169754 59.37 45
upstream ENSMUSE00000516393 Chr8:71080871..71081019 CTGAGCTGAACACGGTGCTA Chr8:71080992..71081011 60.2 55

*** Putative Vector Insertion (Chr 8: 71080870 - 71169835) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000386792 Chr8:70984823..70985750 AGCTGTGTAAGGACGCTGGT Chr8:70984817..70984836 59.94 55
downstream ENSMUSE00000238945 Chr8:70925202..70925418 CGCTAGGGGCACAATAACAT Chr8:70925221..70925240 59.98 50
downstream ENSMUSE00000238937 Chr8:70912495..70912596 AACTCTCCCATCCTGTTGGA Chr8:70912544..70912563 59.51 50
downstream ENSMUSE00000403587 Chr8:70897438..70897616 TCCAACATCCAGTCCCTTTC Chr8:70897519..70897538 59.9 50
downstream ENSMUSE00000238922 Chr8:70896519..70896613 GCCGGGGTTATACTGACTGA Chr8:70896545..70896564 59.96 55
downstream ENSMUSE00000238914 Chr8:70885967..70886048 CCAAAGTCCCTCCAAAATCC Chr8:70885989..70886008 60.66 50
downstream ENSMUSE00000512876 Chr8:70880694..70882612 GTGCGGACCACTATGAGGTT Chr8:70882500..70882519 60 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATTTGGATAATCGCCTTGC Chr8:71136772..71136792 59.04 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGAAACCTCTGGGTGTGG Chr8:71082822..71082842 59.15 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036356