Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35035
Trapped Gene
Rora (ENSMUSG00000032238)
Vector Insertion
Chr 9: 68511995 - 69043881
Public Clones (sanger) (sanger) IST10322C9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696432 (Chr9:68511608..68511994 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGACAAAGACGGAGGAAA Chr9:68511628..68511647 60.22 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696432 (Chr9:68511608..68511994 +)
Downstram Exon
ENSMUSE00000501502 (Chr9:69043882..69043911 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGACAAAGACGGAGGAAA Chr9:68511628..68511647 60.22 50 TGTGTGTCTTCTTCGTGACTGA Chr9:69043909..69043930 59.51 45.46

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696433 Chr9:68501596..68501779 No primer for this exon
upstream ENSMUSE00000427581 Chr9:68501614..68501779 No primer for this exon
upstream ENSMUSE00000427566 Chr9:68511152..68511219 CGACATGTCTCGCTGAAGTC Chr9:68511175..68511194 59.58 55
upstream ENSMUSE00000696432 Chr9:68511608..68511994 CTGGACAAAGACGGAGGAAA Chr9:68511628..68511647 60.22 50

*** Putative Vector Insertion (Chr 9: 68511995 - 69043881) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000501502 Chr9:69043882..69043911 TGTGTGTCTTCTTCGTGACTGA Chr9:69043909..69043930 59.51 45.46
downstream ENSMUSE00000696429 Chr9:69137699..69137855 TCGCTGCGATCACAAAATAC Chr9:69137852..69137871 59.84 45
downstream ENSMUSE00000532251 Chr9:69195939..69196024 CCTGACGATTTGTCTCCACA Chr9:69195990..69196009 59.68 50
downstream ENSMUSE00000218001 Chr9:69209546..69209687 CAGGAGTAGGTGGCATTGCT Chr9:69209592..69209611 60.28 55
downstream ENSMUSE00000236760 Chr9:69211973..69212368 CTTGGACATCCGACCAAACT Chr9:69212001..69212020 59.97 50
downstream ENSMUSE00000218028 Chr9:69219022..69219143 TTCCAGGTGGGATTTGGATA Chr9:69219062..69219081 60.13 45
downstream ENSMUSE00000218019 Chr9:69220896..69221028 AAATCCATCAATGCGTTTGG Chr9:69220988..69221007 60.7 40
downstream ENSMUSE00000218020 Chr9:69221822..69221929 CGCATACTTCCCGTCAAAGT Chr9:69221907..69221926 60.13 50
downstream ENSMUSE00000218003 Chr9:69223192..69223302 ATTTCGTCTTCGGTCAGGTG Chr9:69223270..69223289 60.11 50
downstream ENSMUSE00000218000 Chr9:69224585..69224697 TTCCATCTTCTCGGTGGTTC Chr9:69224689..69224708 60.05 50
downstream ENSMUSE00000584062 Chr9:69226604..69226833 ATGGAGTCGCACAATGTCTG Chr9:69226705..69226724 59.71 50
downstream ENSMUSE00000696428 Chr9:69226604..69227593 CAGGAAAAGCTACGCCAGTC Chr9:69227440..69227459 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGGCCCTCAATTTATCTGG Chr9:68751957..68751977 59.89 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGGCCCTCAATTTATCTGG Chr9:68751957..68751977 59.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032238