Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35039
Trapped Gene
Cbl (ENSMUSG00000034342)
Vector Insertion
Chr 9: 43981335 - 44009291
Public Clones IST13997B8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000426061 (Chr9:44009043..44009290 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGATGGAGACGCTTGGAGAA Chr9:44009153..44009172 59.95 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000426061 (Chr9:44009043..44009290 -)
Downstram Exon
ENSMUSE00000265112 (Chr9:43981336..43981482 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGATGGAGACGCTTGGAGAA Chr9:44009153..44009172 59.95 50 AAGAGTCCGCTCGGAAAGAT Chr9:43981383..43981402 60.35 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000536029 Chr9:44041783..44042129 ACGGTGGACAAGAAGATGGT Chr9:44041811..44041830 59.43 50
upstream ENSMUSE00000426061 Chr9:44009043..44009290 AGATGGAGACGCTTGGAGAA Chr9:44009153..44009172 59.95 50
upstream ENSMUSE00000265112 Chr9:43981336..43981482 ATCTTTCCGAGCGGACTCTT Chr9:43981405..43981424 60.35 50

*** Putative Vector Insertion (Chr 9: 43981335 - 44009291) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000265085 Chr9:43977103..43977259 GAAAGCTCTTCCACGGGACT Chr9:43977212..43977231 60.77 55
downstream ENSMUSE00000265063 Chr9:43975293..43975414 CAGCAAGGCTGTTCCAATTT Chr9:43975353..43975372 60.25 45
downstream ENSMUSE00000536019 Chr9:43974536..43974673 ACAGCTCAGCCGAAAGATGT Chr9:43974630..43974649 60.02 50
downstream ENSMUSE00000265026 Chr9:43972885..43972972 TTTGATTTCGTCCATCAGGA Chr9:43972922..43972941 59.05 40
downstream ENSMUSE00000536014 Chr9:43972209..43972340 GTGTCCACAGGGCTCAATCT Chr9:43972220..43972239 60.12 55
downstream ENSMUSE00000264989 Chr9:43971422..43971625 ATTTCACATCGGCAAAAAGG Chr9:43971563..43971582 59.94 40
downstream ENSMUSE00000264966 Chr9:43967060..43967191 GGTCAAGTCTTGGTGGCACT Chr9:43967097..43967116 60.16 55
downstream ENSMUSE00000264933 Chr9:43966597..43966974 GCCTAGGGACATCTGCTCTG Chr9:43966607..43966626 59.97 60
downstream ENSMUSE00000264913 Chr9:43964699..43964793 AGTAAATGGCGTTGGCAGAC Chr9:43964690..43964709 60.14 50
downstream ENSMUSE00000264891 Chr9:43962273..43962413 GGCAGTTTTGGCATAGGAAG Chr9:43962368..43962387 59.71 50
downstream ENSMUSE00000264870 Chr9:43961844..43961941 GAGGCGCTGTTTTCTGCTAC Chr9:43961824..43961843 60.16 55
downstream ENSMUSE00000264845 Chr9:43960872..43961051 TCATCCTCGTTTTCGGATTC Chr9:43960966..43960985 60.01 45
downstream ENSMUSE00000414458 Chr9:43957345..43959820 CCAACACCATCACGCATTAG Chr9:43958815..43958834 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr9:43994221..43994241 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTGTCAAAACCCAAAGCTG Chr9:43994259..43994279 59.73 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034342