Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35075
Trapped Gene
Pbx3 (ENSMUSG00000038718)
Vector Insertion
Chr 2: 34079924 - 34226418
Public Clones IST12555A10 (tigm) IST14968C7 (tigm) IST12555A10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 26% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000268198 (Chr2:34226344..34226417 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCGTCTTGTGTGAGATCAA Chr2:34226355..34226375 60.04 47.62 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000268198 (Chr2:34226344..34226417 -)
Downstram Exon
ENSMUSE00000268194 (Chr2:34079925..34080166 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCGTCTTGTGTGAGATCAA Chr2:34226355..34226375 60.04 47.62 CTGGGTCAATTTGGCTCTGT Chr2:34079945..34079964 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639898 Chr2:34227241..34227556 ATGACCATCACCGACCAGAG Chr2:34227262..34227281 60.96 55
upstream ENSMUSE00000268198 Chr2:34226344..34226417 CAGCGTCTTGTGTGAGATCAA Chr2:34226355..34226375 60.04 47.62
upstream ENSMUSE00000268194 Chr2:34079925..34080166 GGACAATATGCTTTTGGCAGA Chr2:34080088..34080108 60.09 42.86

*** Putative Vector Insertion (Chr 2: 34079924 - 34226418) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000268188 Chr2:34068772..34068962 ACTGCTTCACACGTGCTTTG Chr2:34068783..34068802 60.1 50
downstream ENSMUSE00000268182 Chr2:34060300..34060435 GTAGGGGTTGCTGAGGTGTG Chr2:34060335..34060354 60.57 60
downstream ENSMUSE00000268176 Chr2:34033697..34033862 GTGGGTGAGTTGGTCTGGTT Chr2:34033689..34033708 59.86 55
downstream ENSMUSE00000567607 Chr2:34032269..34032381 CTTGGGACCCTTGGTAAGAA Chr2:34032270..34032289 59.02 50
downstream ENSMUSE00000567606 Chr2:34031385..34031474 GCCTCCCGTCTGATTGATAA Chr2:34031414..34031433 60.04 50
downstream ENSMUSE00000694445 Chr2:34031385..34031474 GCCTCCCGTCTGATTGATAA Chr2:34031414..34031433 60.04 50
downstream ENSMUSE00000398524 Chr2:34027429..34028493 AAGCCCATCCGTGATATGAG Chr2:34027948..34027967 59.92 50
downstream ENSMUSE00000694443 Chr2:34027429..34028493 AAGCCCATCCGTGATATGAG Chr2:34027948..34027967 59.92 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCTTTTGTTAATCGCCTTG Chr2:34139356..34139376 59.72 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCACGATGAACCATGCTCTT Chr2:34139436..34139456 59.24 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038718