Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35076
Trapped Gene
Zfp54 (ENSMUSG00000023882)
Vector Insertion
Chr 17: 21560526 - 21564700
Public Clones IST11717A11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000613179 (Chr17:21560191..21560525 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCGTGATAGCTGGGACTGTT Chr17:21560247..21560266 60.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000613179 (Chr17:21560191..21560525 +)
Downstram Exon
ENSMUSE00000554445 (Chr17:21564701..21564792 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCGTGATAGCTGGGACTGTT Chr17:21560247..21560266 60.28 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000613179 Chr17:21560191..21560525 GCGTGATAGCTGGGACTGTT Chr17:21560247..21560266 60.28 55
upstream ENSMUSE00000322706 Chr17:21560346..21560414 TGATGCAGACCTGGAGTCAG Chr17:21560366..21560385 59.98 55
upstream ENSMUSE00000658150 Chr17:21560416..21560436 No primer for this exon
upstream ENSMUSE00000390836 Chr17:21560438..21560525 GGGAGGGCTGTAACCTACCA Chr17:21560505..21560524 61.26 60

*** Putative Vector Insertion (Chr 17: 21560526 - 21564700) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000554445 Chr17:21564701..21564792 No primer for this exon
downstream ENSMUSE00000613178 Chr17:21564701..21564792 No primer for this exon
downstream ENSMUSE00000554442 Chr17:21567159..21567285 ATCCCGGAATGTCAACAGAC Chr17:21567182..21567201 59.79 50
downstream ENSMUSE00000430298 Chr17:21570367..21571967 GGTTTGTTCCAGCACGAAGT Chr17:21570936..21570955 60.16 50
downstream ENSMUSE00000532895 Chr17:21570367..21572348 GGTTTGTTCCAGCACGAAGT Chr17:21570936..21570955 60.16 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTAATCGCCTTGCAGCAC Chr17:21563574..21563594 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGAATCAGACAGGGGTGA Chr17:21563556..21563576 59.51 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000023882