Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35079
Trapped Gene
Sclt1 (ENSMUSG00000059834)
Vector Insertion
Chr 3: 41451366 - 41461319
Public Clones IST11717A11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 79% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000274929 (Chr3:41461126..41461318 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGCTTCAGCAGGAAAACG Chr3:41461197..41461216 60.13 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000274929 (Chr3:41461126..41461318 -)
Downstram Exon
ENSMUSE00000675449 (Chr3:41451367..41451563 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGCTTCAGCAGGAAAACG Chr3:41461197..41461216 60.13 50 TGCCTCAGTTCAACAATGGA Chr3:41451438..41451457 60.24 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000568311 Chr3:41545917..41546436 CCTGCGAGGAATCGATAAAC Chr3:41545981..41546000 59.67 50
upstream ENSMUSE00000274815 Chr3:41538090..41538157 GGCAGCATCAAATCGAACAT Chr3:41538114..41538133 61.01 45
upstream ENSMUSE00000377441 Chr3:41534783..41534841 CATGTCCAAAGGAGGCAGAG Chr3:41534817..41534836 60.79 55
upstream ENSMUSE00000153025 Chr3:41534213..41534285 CAGGCAGCTGACCTATTACCA Chr3:41534214..41534234 60.28 52.38
upstream ENSMUSE00000153030 Chr3:41531015..41531070 AAGCACATGGGTGAGATGAA Chr3:41531051..41531070 59.09 45
upstream ENSMUSE00000153031 Chr3:41521651..41521786 GCAGATGATGAGACCGTGAG Chr3:41521685..41521704 59.37 55
upstream ENSMUSE00000153027 Chr3:41515005..41515127 GGAACTCTGGCAGACTGCTT Chr3:41515091..41515110 59.6 55
upstream ENSMUSE00000153033 Chr3:41513391..41513456 AACCAAGAAACTCCATGTTGC Chr3:41513410..41513430 59.09 42.86
upstream ENSMUSE00000153028 Chr3:41507308..41507378 AACCACCACTTCCTGAAAACA Chr3:41507355..41507375 59.48 42.86
upstream ENSMUSE00000153024 Chr3:41486204..41486294 No primer for this exon
upstream ENSMUSE00000153032 Chr3:41485618..41485709 AGAAGCGTCGGATAGACGAG Chr3:41485658..41485677 59.6 55
upstream ENSMUSE00000494211 Chr3:41479250..41479427 GCAATTGAAGAAGCCGATGT Chr3:41479398..41479417 60.22 45
upstream ENSMUSE00000639377 Chr3:41475307..41475405 GATGCAGCTATCAAAGCAAGG Chr3:41475313..41475333 60 47.62
upstream ENSMUSE00000344043 Chr3:41471033..41471104 No primer for this exon
upstream ENSMUSE00000274944 Chr3:41467874..41467948 GAGCCGTGGAAGAAGAACTG Chr3:41467880..41467899 59.99 55
upstream ENSMUSE00000274938 Chr3:41465494..41465639 CTTGCTGCAGAACGTTCAAA Chr3:41465554..41465573 60.17 45
upstream ENSMUSE00000274929 Chr3:41461126..41461318 GAAGCTTCAGCAGGAAAACG Chr3:41461197..41461216 60.13 50
upstream ENSMUSE00000675449 Chr3:41451367..41451563 TTTGGCAGCTCAACAAAAGA Chr3:41451437..41451456 59.58 40

*** Putative Vector Insertion (Chr 3: 41451366 - 41461319) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000675446 Chr3:41435575..41435653 CCACCTTTTCATTTGCCATT Chr3:41435558..41435577 59.8 40
downstream ENSMUSE00000675444 Chr3:41433440..41433535 TGCCTGACTTAGACGCCTTT Chr3:41433448..41433467 60.01 50
downstream ENSMUSE00000675442 Chr3:41430627..41431156 CCATTCTCAGCAGGCTTCTC Chr3:41430985..41431004 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCACGTTCCCATGAAATG Chr3:41461283..41461303 60.37 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCACGTTCCCATGAAATG Chr3:41461283..41461303 60.37 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000059834