Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35106
Trapped Gene
Ss18l1 (ENSMUSG00000039086)
Vector Insertion
Chr 2: 179798104 - 179802036
Public Clones IST15062F7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 98% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000661155 (Chr2:179797976..179798103 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCCTTACGGCTATGAACAG Chr2:179798084..179798103 59.73 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000661155 (Chr2:179797976..179798103 +)
Downstram Exon
ENSMUSE00000573166 (Chr2:179802037..179804905 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCCTTACGGCTATGAACAG Chr2:179798084..179798103 59.73 55 ACCAGACATGTCACGCCATA Chr2:179802255..179802274 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000516636 Chr2:179777214..179777573 CACTCAGCAGACCATCCAGA Chr2:179777552..179777571 59.98 55
upstream ENSMUSE00000227722 Chr2:179787169..179787245 CCTGGACTACCAGAGCAAGG Chr2:179787204..179787223 59.86 60
upstream ENSMUSE00000227719 Chr2:179788014..179788098 CACCGGAACCTGGTCTACCT Chr2:179788030..179788049 61.33 60
upstream ENSMUSE00000227716 Chr2:179789724..179789868 GCACTGAGTCAGAGTGGTTCC Chr2:179789757..179789777 59.9 57.14
upstream ENSMUSE00000227712 Chr2:179790406..179790603 GTCTCGGACCAACATCAACA Chr2:179790569..179790588 59.53 50
upstream ENSMUSE00000488855 Chr2:179792290..179792454 AGCCACGTCCCACTACAACT Chr2:179792312..179792331 59.65 55
upstream ENSMUSE00000227702 Chr2:179792793..179792894 GTACCTGGGCCAAGAGGAGT Chr2:179792806..179792825 60.51 60
upstream ENSMUSE00000227697 Chr2:179794041..179794133 AGAGCTACGACCGCTCCTTT Chr2:179794083..179794102 60.54 55
upstream ENSMUSE00000227693 Chr2:179796615..179796734 AGCAGACCTACTCCCAGCAA Chr2:179796669..179796688 60.01 55
upstream ENSMUSE00000661155 Chr2:179797976..179798103 GGCCTTACGGCTATGAACAG Chr2:179798084..179798103 59.73 55

*** Putative Vector Insertion (Chr 2: 179798104 - 179802036) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000573166 Chr2:179802037..179804905 ACCAGACATGTCACGCCATA Chr2:179802255..179802274 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCTTACGGCTATGAACAG Chr2:179798085..179798105 59.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000039086