Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35107
Trapped Gene
D7Ertd443e (ENSMUSG00000030994)
Vector Insertion
Chr 7: 141490827 - 141541512
Public Clones IST13665E6 (tigm) IST12346B8 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000587421 (Chr7:141540395..141541511 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCACACGAATGACAATGAGG Chr7:141540938..141540957 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000587421 (Chr7:141540395..141541511 -)
Downstram Exon
ENSMUSE00000668717 (Chr7:141490828..141490834 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCACACGAATGACAATGAGG Chr7:141540938..141540957 59.96 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668722 Chr7:141568400..141568511 ACTCCTGGGAGCCTTACCTC Chr7:141568416..141568435 59.7 60
upstream ENSMUSE00000587421 Chr7:141540395..141541511 CCACACGAATGACAATGAGG Chr7:141540938..141540957 59.96 50
upstream ENSMUSE00000668717 Chr7:141490828..141490834 No primer for this exon

*** Putative Vector Insertion (Chr 7: 141490827 - 141541512) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000668716 Chr7:141490239..141490244 No primer for this exon
downstream ENSMUSE00000587424 Chr7:141489799..141490083 GTGAACTGTCCCCTTCAGGA Chr7:141489945..141489964 60.09 55
downstream ENSMUSE00000205272 Chr7:141486648..141486826 CAGTGGGGTCTTCGTTCTTC Chr7:141486742..141486761 59.7 55
downstream ENSMUSE00000205277 Chr7:141484911..141485088 TAAGCTTTTGCAGCCGTTCT Chr7:141485003..141485022 60.15 45
downstream ENSMUSE00000205274 Chr7:141461877..141461940 GCATCTTTCTTTGGGTTTGAA Chr7:141461890..141461910 59.19 38.1
downstream ENSMUSE00000205276 Chr7:141458421..141458520 TCGGAGCCGGTTACTCTGTA Chr7:141458417..141458436 60.79 55
downstream ENSMUSE00000369578 Chr7:141457945..141458334 GTAGGTCCCGAGGTGTTGAA Chr7:141458039..141458058 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTGGGGACAGTGGTGAAG Chr7:141502471..141502491 60.56 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GACTGGGGACAGTGGTGAAG Chr7:141502471..141502491 60.56 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030994