Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35109
Trapped Gene
Man1b1 (ENSMUSG00000036646)
Vector Insertion
Chr 2: 25188103 - 25188275
Public Clones IST14807F4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698883 (Chr2:25187935..25188102 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGCCAGACGTAACTGCAA Chr2:25187991..25188010 60.05 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698883 (Chr2:25187935..25188102 +)
Downstram Exon
ENSMUSE00000445160 (Chr2:25188276..25188496 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGCCAGACGTAACTGCAA Chr2:25187991..25188010 60.05 50 ATAACGAAGGCATCCACACC Chr2:25188304..25188323 59.82 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698883 Chr2:25187935..25188102 CAAGCCAGACGTAACTGCAA Chr2:25187991..25188010 60.05 50

*** Putative Vector Insertion (Chr 2: 25188103 - 25188275) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000445160 Chr2:25188276..25188496 ATAACGAAGGCATCCACACC Chr2:25188304..25188323 59.82 50
downstream ENSMUSE00000445144 Chr2:25188955..25189063 AATCACATTCCGCTGTAGCC Chr2:25188996..25189015 60.1 50
downstream ENSMUSE00000445140 Chr2:25189897..25190012 AGGCAGGACTTCTTGCTTCA Chr2:25189952..25189971 60.13 50
downstream ENSMUSE00000242453 Chr2:25193633..25193787 CCCATCCTTGGAGACTGTGT Chr2:25193710..25193729 59.96 55
downstream ENSMUSE00000242449 Chr2:25197127..25197236 GGAAGTTCAGTGGCCTGTTC Chr2:25197174..25197193 59.7 55
downstream ENSMUSE00000714026 Chr2:25198744..25198929 TTGCTTCAGACCCAAAATCC Chr2:25198931..25198950 60.05 45
downstream ENSMUSE00000715697 Chr2:25198744..25198929 TTGCTTCAGACCCAAAATCC Chr2:25198931..25198950 60.05 45
downstream ENSMUSE00000242442 Chr2:25200488..25200636 CCTAAGATGCGAATGGTGCT Chr2:25200584..25200603 60.24 50
downstream ENSMUSE00000698872 Chr2:25200488..25200636 CCTAAGATGCGAATGGTGCT Chr2:25200584..25200603 60.24 50
downstream ENSMUSE00000242438 Chr2:25200926..25201114 CTCCAACTGAATGCTCGTCA Chr2:25201075..25201094 59.98 50
downstream ENSMUSE00000698871 Chr2:25200926..25201114 CTCCAACTGAATGCTCGTCA Chr2:25201075..25201094 59.98 50
downstream ENSMUSE00000242436 Chr2:25203556..25203746 CTGGATCCACTGTTTCAGCA Chr2:25203729..25203748 59.83 50
downstream ENSMUSE00000698870 Chr2:25203556..25203746 CTGGATCCACTGTTTCAGCA Chr2:25203729..25203748 59.83 50
downstream ENSMUSE00000242433 Chr2:25204091..25204211 AGCTTTCTGGGCTGAGACTG Chr2:25204168..25204187 59.74 55
downstream ENSMUSE00000698869 Chr2:25204091..25204211 AGCTTTCTGGGCTGAGACTG Chr2:25204168..25204187 59.74 55
downstream ENSMUSE00000242427 Chr2:25204690..25204887 CCGAGCTAGATCCATGTGGT Chr2:25204776..25204795 60.1 55
downstream ENSMUSE00000698868 Chr2:25204690..25204887 CCGAGCTAGATCCATGTGGT Chr2:25204776..25204795 60.1 55
downstream ENSMUSE00000242423 Chr2:25204971..25205102 TAGGCTTTCCACCGTCTCTG Chr2:25205021..25205040 60.39 55
downstream ENSMUSE00000698867 Chr2:25204971..25205102 TAGGCTTTCCACCGTCTCTG Chr2:25205021..25205040 60.39 55
downstream ENSMUSE00000380274 Chr2:25205882..25207732 CCCTTGACACCAGCCATAGT Chr2:25207515..25207534 59.99 55
downstream ENSMUSE00000698865 Chr2:25205882..25207732 CCCTTGACACCAGCCATAGT Chr2:25207515..25207534 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACGTAAGGACGCGATGAAAT Chr2:25188102..25188122 59.6 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGTAAGGACGCGATGAAAT Chr2:25188102..25188122 59.6 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036646