Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3512
Trapped Gene
Cask (ENSMUSG00000031012)
Vector Insertion
Chr X: 13162668 - 13163969
Public Clones AE0541 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000557415 (ChrX:13163970..13164091 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGGACAGCCTGGAAGAGATT ChrX:13164054..13164073 59.8 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000557415 (ChrX:13163970..13164091 -)
Downstram Exon
ENSMUSE00000702852 (ChrX:13162659..13162667 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGGACAGCCTGGAAGAGATT ChrX:13164054..13164073 59.8 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720037 ChrX:13423134..13423682 TGTACGAGCTATGCGAGGTG ChrX:13423142..13423161 60.03 55
upstream ENSMUSE00000720834 ChrX:13423134..13423682 TGTACGAGCTATGCGAGGTG ChrX:13423142..13423161 60.03 55
upstream ENSMUSE00000472905 ChrX:13363063..13363175 TCAGTGTTGTACGGCGATGT ChrX:13363148..13363167 60.18 50
upstream ENSMUSE00000702894 ChrX:13363063..13363175 TCAGTGTTGTACGGCGATGT ChrX:13363148..13363167 60.18 50
upstream ENSMUSE00000490154 ChrX:13291792..13291897 ATCTAAAGCGGGAAGCCAGT ChrX:13291878..13291897 60.23 50
upstream ENSMUSE00000702892 ChrX:13291792..13291897 ATCTAAAGCGGGAAGCCAGT ChrX:13291878..13291897 60.23 50
upstream ENSMUSE00000486901 ChrX:13260097..13260174 ATCGTAAAGCGAGCTGATGC ChrX:13260127..13260146 60.52 50
upstream ENSMUSE00000702891 ChrX:13260097..13260174 ATCGTAAAGCGAGCTGATGC ChrX:13260127..13260146 60.52 50
upstream ENSMUSE00000476974 ChrX:13254711..13254783 GAAGCTCTGCGCTACTGTCA ChrX:13254742..13254761 59.49 55
upstream ENSMUSE00000702890 ChrX:13254711..13254783 GAAGCTCTGCGCTACTGTCA ChrX:13254742..13254761 59.49 55
upstream ENSMUSE00000489180 ChrX:13203321..13203423 TGTTAAACTTGGGGGCTTTG ChrX:13203363..13203382 59.97 45
upstream ENSMUSE00000702889 ChrX:13203321..13203423 TGTTAAACTTGGGGGCTTTG ChrX:13203363..13203382 59.97 45
upstream ENSMUSE00000478755 ChrX:13197776..13197951 TGCCTTTCTACGGAACCAAG ChrX:13197815..13197834 60.24 50
upstream ENSMUSE00000702886 ChrX:13197776..13197951 TGCCTTTCTACGGAACCAAG ChrX:13197815..13197834 60.24 50
upstream ENSMUSE00000475890 ChrX:13191596..13191718 CAAGGCAGTGGAGCCATATC ChrX:13191692..13191711 60.62 55
upstream ENSMUSE00000702885 ChrX:13191596..13191718 CAAGGCAGTGGAGCCATATC ChrX:13191692..13191711 60.62 55
upstream ENSMUSE00000479859 ChrX:13185860..13185943 CGGGATCGTTATGCCTACAA ChrX:13185921..13185940 60.85 50
upstream ENSMUSE00000702884 ChrX:13185860..13185943 CGGGATCGTTATGCCTACAA ChrX:13185921..13185940 60.85 50
upstream ENSMUSE00000480948 ChrX:13177483..13177582 TCCGAAGACCCTACCTCCTC ChrX:13177485..13177504 60.59 60
upstream ENSMUSE00000702883 ChrX:13177483..13177582 TCCGAAGACCCTACCTCCTC ChrX:13177485..13177504 60.59 60
upstream ENSMUSE00000702867 ChrX:13173812..13173829 No primer for this exon
upstream ENSMUSE00000702881 ChrX:13173812..13173829 No primer for this exon
upstream ENSMUSE00000557415 ChrX:13163970..13164091 TGGACAGCCTGGAAGAGATT ChrX:13164054..13164073 59.8 50
upstream ENSMUSE00000702880 ChrX:13163970..13164091 TGGACAGCCTGGAAGAGATT ChrX:13164054..13164073 59.8 50

*** Putative Vector Insertion (Chr X: 13162668 - 13163969) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000702852 ChrX:13162659..13162667 No primer for this exon
downstream ENSMUSE00000495304 ChrX:13148160..13148237 ATTCCTGATTTGTGGCGAAG ChrX:13148171..13148190 60.07 45
downstream ENSMUSE00000702877 ChrX:13148160..13148237 ATTCCTGATTTGTGGCGAAG ChrX:13148171..13148190 60.07 45
downstream ENSMUSE00000484789 ChrX:13145602..13145682 CGCTTTAGTTCCTTCGCATC ChrX:13145605..13145624 59.98 50
downstream ENSMUSE00000702876 ChrX:13145602..13145682 CGCTTTAGTTCCTTCGCATC ChrX:13145605..13145624 59.98 50
downstream ENSMUSE00000497590 ChrX:13138641..13138829 GTACCAGCCGAACTCTGGTC ChrX:13138648..13138667 59.73 60
downstream ENSMUSE00000702875 ChrX:13138641..13138829 GTACCAGCCGAACTCTGGTC ChrX:13138648..13138667 59.73 60
downstream ENSMUSE00000486017 ChrX:13136446..13136524 ATACCCCCATGCATGATTCT ChrX:13136438..13136457 59.08 45
downstream ENSMUSE00000702874 ChrX:13136446..13136524 ATACCCCCATGCATGATTCT ChrX:13136438..13136457 59.08 45
downstream ENSMUSE00000483938 ChrX:13134118..13134203 TTGGTTAGCGACACTGATGC ChrX:13134123..13134142 59.87 50
downstream ENSMUSE00000205472 ChrX:13132004..13132072 GCTTGGCACAATCTTGAAGG ChrX:13132009..13132028 60.78 50
downstream ENSMUSE00000702860 ChrX:13131971..13132072 GCTTGGCACAATCTTGAAGG ChrX:13132009..13132028 60.78 50
downstream ENSMUSE00000702858 ChrX:13131891..13131965 GCAAAAACATTCAGCCATCA ChrX:13131890..13131909 59.67 40
downstream ENSMUSE00000702857 ChrX:13131839..13131886 No primer for this exon
downstream ENSMUSE00000702855 ChrX:13131747..13131836 ACATGCAAGTAGGGCTGAGG ChrX:13131779..13131798 60.28 55
downstream ENSMUSE00000205476 ChrX:13129499..13129567 CAGGGGACTGTCTGGAAGTG ChrX:13129512..13129531 60.7 60
downstream ENSMUSE00000205498 ChrX:13128073..13128108 CTTTTGGTTGGGTGGTTGAT ChrX:13128059..13128078 59.69 45
downstream ENSMUSE00000205501 ChrX:13126291..13126487 CAGTTTACCCTGCCACCAGT ChrX:13126325..13126344 60.03 55
downstream ENSMUSE00000205487 ChrX:13121640..13121755 CATGGCAATGCAAGCTACTC ChrX:13121712..13121731 59.45 50
downstream ENSMUSE00000501437 ChrX:13114887..13114967 TTTTGAATGCTGGCAGTTTG ChrX:13114886..13114905 59.85 40
downstream ENSMUSE00000702866 ChrX:13114887..13114965 TTTTGAATGCTGGCAGTTTG ChrX:13114886..13114905 59.85 40
downstream ENSMUSE00000205486 ChrX:13114712..13114792 CTTCTTCCAACACCATGTGC ChrX:13114749..13114768 59.14 50
downstream ENSMUSE00000702865 ChrX:13114712..13114792 CTTCTTCCAACACCATGTGC ChrX:13114749..13114768 59.14 50
downstream ENSMUSE00000255190 ChrX:13110466..13110668 TGGATTTTCCGAATGGTCTC ChrX:13110484..13110503 59.87 45
downstream ENSMUSE00000702864 ChrX:13110466..13110668 TGGATTTTCCGAATGGTCTC ChrX:13110484..13110503 59.87 45
downstream ENSMUSE00000702873 ChrX:13103819..13103893 CTTTCCAAAACGTGGCAAAT ChrX:13103797..13103816 59.97 40
downstream ENSMUSE00000205495 ChrX:13103124..13103207 AGGAGCAAACTCTGCAGTCC ChrX:13103150..13103169 59.6 55
downstream ENSMUSE00000702863 ChrX:13103124..13103207 AGGAGCAAACTCTGCAGTCC ChrX:13103150..13103169 59.6 55
downstream ENSMUSE00000702862 ChrX:13101951..13101977 AGGCAATTTTCTGCACCATT ChrX:13101929..13101948 59.57 40
downstream ENSMUSE00000702871 ChrX:13098541..13099473 AGTTTTTAGGGGCCTTGGAA ChrX:13098953..13098972 59.94 45
downstream ENSMUSE00000509562 ChrX:13098173..13099473 AATGGCGAAACCAGCAATAC ChrX:13098354..13098373 59.97 45
downstream ENSMUSE00000702861 ChrX:13098173..13099473 AATGGCGAAACCAGCAATAC ChrX:13098354..13098373 59.97 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTTAATCGCCTTGCAGCAC ChrX:13163901..13163921 61.26 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTCGTGACTGGGAAAACC ChrX:13163902..13163922 58.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031012