Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35124
Trapped Gene
Hormad1 (ENSMUSG00000028109)
Vector Insertion
Chr 3: 95363655 - 95365149
Public Clones IST14698D1 (tigm) IST14698D1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000672252 (Chr3:95363600..95363654 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000672252 (Chr3:95363600..95363654 +)
Downstram Exon
ENSMUSE00000402116 (Chr3:95365150..95365202 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCTCTGCAACTGCATAGTGG Chr3:95365193..95365212 59.47 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000252075 Chr3:95363599..95363645 No primer for this exon
upstream ENSMUSE00000672252 Chr3:95363600..95363654 No primer for this exon

*** Putative Vector Insertion (Chr 3: 95363655 - 95365149) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000402116 Chr3:95365150..95365202 CCTCTGCAACTGCATAGTGG Chr3:95365193..95365212 59.47 55
downstream ENSMUSE00000708265 Chr3:95365150..95365202 CCTCTGCAACTGCATAGTGG Chr3:95365193..95365212 59.47 55
downstream ENSMUSE00000176269 Chr3:95366402..95366546 CCATAAGCACGTTCTGGAAA Chr3:95366532..95366551 58.77 45
downstream ENSMUSE00000176262 Chr3:95370543..95370606 GCTGTGAAGAACCTGGACAA Chr3:95370599..95370618 58.85 50
downstream ENSMUSE00000176266 Chr3:95371606..95371642 AGCATCATAGCATCCAAGCA Chr3:95371630..95371649 59.4 45
downstream ENSMUSE00000672251 Chr3:95374588..95374608 No primer for this exon
downstream ENSMUSE00000176267 Chr3:95374850..95374876 TGAGGATCTCCTGGATTGGT Chr3:95374878..95374897 59.46 50
downstream ENSMUSE00000176265 Chr3:95379457..95379524 TGATTGGTCCATTTTTGGTG Chr3:95379514..95379533 59.22 40
downstream ENSMUSE00000176260 Chr3:95380199..95380350 TGCTTTCTTGGTGTCAGCAG Chr3:95380253..95380272 60.17 50
downstream ENSMUSE00000176259 Chr3:95381975..95382222 CCTGGTGGTTGGTAATCTGG Chr3:95382005..95382024 60.22 55
downstream ENSMUSE00000176264 Chr3:95383927..95383993 TCCAGAGTTTTCATTCTGTTCGT Chr3:95383977..95383999 60.16 39.13
downstream ENSMUSE00000176268 Chr3:95384080..95384156 TGGCTCTTTTTGAATTGCAT Chr3:95384134..95384153 58.36 35
downstream ENSMUSE00000252010 Chr3:95385429..95385512 TTTCCGCTTCTTGTTTTGCT Chr3:95385496..95385515 60 40
downstream ENSMUSE00000333139 Chr3:95389062..95389136 CGAAGACTTCTCTTCCGATTTT Chr3:95389121..95389142 59.02 40.91
downstream ENSMUSE00000566220 Chr3:95389457..95389511 AGGGCATCTTGTTTGTCACC Chr3:95389498..95389517 59.97 50
downstream ENSMUSE00000588559 Chr3:95391303..95391517 No primer for this exon
downstream ENSMUSE00000588560 Chr3:95391303..95391593 No primer for this exon
downstream ENSMUSE00000672244 Chr3:95391303..95391518 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCGGTGCGTAAAGTATGTT Chr3:95363643..95363663 60.03 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGCGGTGCGTAAAGTATGTT Chr3:95363643..95363663 60.03 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000028109