Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35125
Trapped Gene
Pacsin1 (ENSMUSG00000040276)
Vector Insertion
Chr 17: 27822371 - 27838770
Public Clones IST14981F10 (tigm) IST10983G11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657940 (Chr17:27822199..27822370 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657940 (Chr17:27822199..27822370 +)
Downstram Exon
ENSMUSE00000700853 (Chr17:27838771..27838886 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CCTCATCGTAGGAGCCAGAC Chr17:27838857..27838876 59.83 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700859 Chr17:27792454..27792704 CCTTCTCCTCCTCCTTTTCC Chr17:27792584..27792603 59.25 55
upstream ENSMUSE00000460067 Chr17:27792533..27792704 CCTTCTCCTCCTCCTTTTCC Chr17:27792584..27792603 59.25 55
upstream ENSMUSE00000700854 Chr17:27792588..27792704 TCCTCCTCCTTTTCCTCCTC Chr17:27792589..27792608 59.75 55
upstream ENSMUSE00000657940 Chr17:27822199..27822370 No primer for this exon

*** Putative Vector Insertion (Chr 17: 27822371 - 27838770) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000700857 Chr17:27838677..27838886 CCTCATCGTAGGAGCCAGAC Chr17:27838857..27838876 59.83 60
downstream ENSMUSE00000460051 Chr17:27838712..27838886 CGGAGGTGAGAGAAGTGGTC Chr17:27838753..27838772 59.83 60
downstream ENSMUSE00000715728 Chr17:27838712..27838886 CGGAGGTGAGAGAAGTGGTC Chr17:27838753..27838772 59.83 60
downstream ENSMUSE00000700853 Chr17:27838771..27838886 CCTCATCGTAGGAGCCAGAC Chr17:27838857..27838876 59.83 60
downstream ENSMUSE00000460033 Chr17:27839645..27839801 CTTCACCGTCCGCTTGTAGT Chr17:27839674..27839693 60.31 55
downstream ENSMUSE00000460027 Chr17:27841790..27842025 AGCTCGCTGACCTTATCTGC Chr17:27841862..27841881 59.75 55
downstream ENSMUSE00000460023 Chr17:27842570..27842725 TGCATTTGTCCACTTTGTCC Chr17:27842711..27842730 59.55 45
downstream ENSMUSE00000460015 Chr17:27842862..27843037 AGGTTGAGATGCCGTTTGAT Chr17:27843025..27843044 59.56 45
downstream ENSMUSE00000245756 Chr17:27843939..27844059 TCCAGTTCTCGGTAGACATGC Chr17:27843967..27843987 60.27 52.38
downstream ENSMUSE00000245736 Chr17:27844164..27844291 CTCCTTCTTGGCAGTGGTGT Chr17:27844208..27844227 60.3 55
downstream ENSMUSE00000459997 Chr17:27844825..27845012 CACTCGGTGGCATATGTTTG Chr17:27844869..27844888 59.99 50
downstream ENSMUSE00000348638 Chr17:27845371..27848051 GCCAGGTGAGAGCCTTGTAG Chr17:27846458..27846477 60.01 60
downstream ENSMUSE00000657939 Chr17:27845371..27845604 CACCAACCCTGTTCGTCTTC Chr17:27845419..27845438 60.54 55
downstream ENSMUSE00000700852 Chr17:27845371..27845622 CACCAACCCTGTTCGTCTTC Chr17:27845419..27845438 60.54 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGGAGAAGTCTGCGTGGAG Chr17:27831391..27831411 61.01 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGGAGAAGTCTGCGTGGAG Chr17:27831391..27831411 61.01 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040276