Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3513
Trapped Gene
Zfp472 (ENSMUSG00000053600)
Vector Insertion
Chr 17: 33102875 - 33112858
Public Clones AB0136 (sanger) IST12067C4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657707 (Chr17:33102854..33102874 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCATCAGAAGCAGGAAATG Chr17:33102855..33102874 59.95 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657707 (Chr17:33102854..33102874 +)
Downstram Exon
ENSMUSE00000547132 (Chr17:33112859..33112985 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCATCAGAAGCAGGAAATG Chr17:33102855..33102874 59.95 45 TGAAGTTCACAGCCACATCC Chr17:33112898..33112917 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657707 Chr17:33102854..33102874 TGCATCAGAAGCAGGAAATG Chr17:33102855..33102874 59.95 45

*** Putative Vector Insertion (Chr 17: 33102875 - 33112858) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000547132 Chr17:33112859..33112985 TGAAGTTCACAGCCACATCC Chr17:33112898..33112917 59.68 50
downstream ENSMUSE00000308419 Chr17:33113172..33113229 No primer for this exon
downstream ENSMUSE00000500097 Chr17:33114104..33116156 CAGACACAGGGCTTCTCTCC Chr17:33114916..33114935 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAGGAAGAACGCCTGGATG Chr17:33102838..33102858 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTAGGAAGAACGCCTGGATG Chr17:33102838..33102858 59.69 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053600