Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35131
Trapped Gene
Slc10a3 (ENSMUSG00000032806)
Vector Insertion
Chr X: 71617952 - 71618586
Public Clones IST14466G3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000698276 (ChrX:71618548..71618585 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTTGTGAGGAGCTCTGTGG ChrX:71618560..71618579 58.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000698276 (ChrX:71618548..71618585 -)
Downstram Exon
ENSMUSE00000413735 (ChrX:71617953..71618021 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTTGTGAGGAGCTCTGTGG ChrX:71618560..71618579 58.01 55 CAGCCTTGAATCTCGCTGAT ChrX:71617947..71617966 60.5 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000698276 ChrX:71618548..71618585 ACTTGTGAGGAGCTCTGTGG ChrX:71618560..71618579 58.01 55
upstream ENSMUSE00000265614 ChrX:71618530..71618637 GGGCCACTACTTGTGAGGAG ChrX:71618568..71618587 59.72 60
upstream ENSMUSE00000498207 ChrX:71618530..71618644 GGGCCACTACTTGTGAGGAG ChrX:71618568..71618587 59.72 60
upstream ENSMUSE00000413735 ChrX:71617953..71618021 TCCCTCTTCATCAGCGAGAT ChrX:71617978..71617997 59.91 50

*** Putative Vector Insertion (Chr X: 71617952 - 71618586) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000698284 ChrX:71615867..71616350 GAGCCATCCCCAATACTCAA ChrX:71615987..71616006 59.89 50
downstream ENSMUSE00000655034 ChrX:71614582..71616350 GTTTTGCACCCCTACCTCAA ChrX:71614927..71614946 59.97 50
downstream ENSMUSE00000655036 ChrX:71614556..71616350 GTTTTGCACCCCTACCTCAA ChrX:71614927..71614946 59.97 50
downstream ENSMUSE00000698281 ChrX:71614556..71615779 GTTTTGCACCCCTACCTCAA ChrX:71614927..71614946 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCCACTACTTGTGAGGAG ChrX:71618566..71618586 59.72 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGGCCACTACTTGTGAGGAG ChrX:71618566..71618586 59.72 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032806