Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35136
Trapped Gene
Dhrs3 (ENSMUSG00000066026)
Vector Insertion
Chr 4: 144483613 - 144508553
Public Clones IST11218H3 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 21% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000667383 (Chr4:144483488..144483612 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAGTCAGTCCTCATCACC Chr4:144483530..144483549 59.49 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000667383 (Chr4:144483488..144483612 +)
Downstram Exon
ENSMUSE00000524269 (Chr4:144508554..144508697 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAGTCAGTCCTCATCACC Chr4:144483530..144483549 59.49 60 CTTCTCTCGGACAGCTTTGG Chr4:144508700..144508719 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000667384 Chr4:144482730..144482813 ACTTTCGCGGACTGAAATTG Chr4:144482773..144482792 60.25 45
upstream ENSMUSE00000524265 Chr4:144483064..144483612 CTCGCCCTGTCCTTTACATC Chr4:144483230..144483249 59.69 55
upstream ENSMUSE00000667383 Chr4:144483488..144483612 GGGAGTCAGTCCTCATCACC Chr4:144483530..144483549 59.49 60

*** Putative Vector Insertion (Chr 4: 144483613 - 144508553) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000524269 Chr4:144508554..144508697 CTTCTCTCGGACAGCTTTGG Chr4:144508700..144508719 60.13 55
downstream ENSMUSE00000524264 Chr4:144509288..144509407 GTTGACATGCTGGGACTTGA Chr4:144509392..144509411 59.68 50
downstream ENSMUSE00000524268 Chr4:144509744..144509982 ACAATATGGCCGTTCTGGAG Chr4:144509799..144509818 59.96 50
downstream ENSMUSE00000524267 Chr4:144513809..144513934 CTGGTTTTGTTGCACAGCAT Chr4:144513887..144513906 59.76 45
downstream ENSMUSE00000524263 Chr4:144517038..144517544 CAGGTGTAAGTCCCCGAGAA Chr4:144517097..144517116 60.1 55
downstream ENSMUSE00000667382 Chr4:144517038..144517545 CAGGTGTAAGTCCCCGAGAA Chr4:144517097..144517116 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr4:144489663..144489683 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGACGTGACTGGGAAAACC Chr4:144489660..144489680 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066026