Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35139
Trapped Gene
Tob2 (ENSMUSG00000078960)
Vector Insertion
Chr 15: 81688103 - 81689227
Public Clones IST14032G12 (tigm) IST14032G12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 41% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000253119 (Chr15:81688953..81689226 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TAATGGCCTGTTGTGTTCCA Chr15:81689090..81689109 59.96 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000253119 (Chr15:81688953..81689226 -)
Downstram Exon
ENSMUSE00000488485 (Chr15:81688104..81688690 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TAATGGCCTGTTGTGTTCCA Chr15:81689090..81689109 59.96 45 TCAGTCTCAACGACCTGCAC Chr15:81688639..81688658 60.03 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000253119 Chr15:81688953..81689226 TAATGGCCTGTTGTGTTCCA Chr15:81689090..81689109 59.96 45
upstream ENSMUSE00000488485 Chr15:81688104..81688690 GTGCAGGTCGTTGAGACTGA Chr15:81688661..81688680 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGAGCTGGTAATCGCCTTG Chr15:81689165..81689185 59.98 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTTTGAGAGCTGGCGTGAC Chr15:81689170..81689190 60.6 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000078960