Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35140
Trapped Gene
Cd302 (ENSMUSG00000060703)
Vector Insertion
Chr 2: 60090049 - 60093155
Public Clones IST11217E7 (tigm) IST11217E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 72% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000165047 (Chr2:60093128..60093154 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000165047 (Chr2:60093128..60093154 -)
Downstram Exon
ENSMUSE00000506452 (Chr2:60090050..60090548 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AATGATCGCTCCCAAAACTG Chr2:60090456..60090475 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000513230 Chr2:60122117..60122181 No primer for this exon
upstream ENSMUSE00000512182 Chr2:60110159..60110269 CTACCTGGGTCCAGTTCCAA Chr2:60110238..60110257 59.96 55
upstream ENSMUSE00000511099 Chr2:60095940..60096056 ACTTTGCAAAAGCGATGGAA Chr2:60095984..60096003 60.75 40
upstream ENSMUSE00000165053 Chr2:60095090..60095260 AAGTGGGCAGATCAAGATGG Chr2:60095197..60095216 60.07 50
upstream ENSMUSE00000165047 Chr2:60093128..60093154 No primer for this exon
upstream ENSMUSE00000506452 Chr2:60090050..60090548 CAGTTTTGGGAGCGATCATT Chr2:60090478..60090497 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATAATCGCCTTGCAGCACA Chr2:60093086..60093106 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTTTAACGTGACTGGGAAAACC Chr2:60093088..60093111 60.48 39.13 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060703