Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35144
Trapped Gene
Fbln1 (ENSMUSG00000006369)
Vector Insertion
Chr 15: 85095812 - 85115469
Public Clones (ggtc) IST14634C2 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000315213 (Chr15:85095680..85095811 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000315213 (Chr15:85095680..85095811 +)
Downstram Exon
ENSMUSE00000378440 (Chr15:85115470..85115609 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000412282 Chr15:85036486..85036642 No primer for this exon
upstream ENSMUSE00000413978 Chr15:85052334..85052439 No primer for this exon
upstream ENSMUSE00000369120 Chr15:85054680..85054815 No primer for this exon
upstream ENSMUSE00000315293 Chr15:85057398..85057569 No primer for this exon
upstream ENSMUSE00000126450 Chr15:85059990..85060046 No primer for this exon
upstream ENSMUSE00000126434 Chr15:85061229..85061330 No primer for this exon
upstream ENSMUSE00000315274 Chr15:85061847..85061984 No primer for this exon
upstream ENSMUSE00000315266 Chr15:85062969..85063106 No primer for this exon
upstream ENSMUSE00000126448 Chr15:85068038..85068181 No primer for this exon
upstream ENSMUSE00000126436 Chr15:85068893..85069021 No primer for this exon
upstream ENSMUSE00000126457 Chr15:85069724..85069849 No primer for this exon
upstream ENSMUSE00000126432 Chr15:85071050..85071169 No primer for this exon
upstream ENSMUSE00000126442 Chr15:85072441..85072572 No primer for this exon
upstream ENSMUSE00000126438 Chr15:85074613..85074736 No primer for this exon
upstream ENSMUSE00000680259 Chr15:85081875..85082308 No primer for this exon
upstream ENSMUSE00000126440 Chr15:85093689..85093831 No primer for this exon
upstream ENSMUSE00000315213 Chr15:85095680..85095811 No primer for this exon

*** Putative Vector Insertion (Chr 15: 85095812 - 85115469) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000378440 Chr15:85115470..85115609 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTCCCAGACAGTGAGTCT Chr15:85104834..85104854 59.43 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCCCTCCCAGAAGTAAACC Chr15:85104827..85104848 60.35 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000006369