Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35147
Trapped Gene
2810485I05Rik (ENSMUSG00000037808)
Vector Insertion
Chr 9: 13644186 - 13648472
Public Clones IST12742A5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000311526 (Chr9:13644084..13644185 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTATGGAAAAAGCGCACA Chr9:13644143..13644162 59.87 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000311526 (Chr9:13644084..13644185 +)
Downstram Exon
ENSMUSE00000340401 (Chr9:13648473..13650973 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTATGGAAAAAGCGCACA Chr9:13644143..13644162 59.87 45 AACAGGCTCATCGGAAAATG Chr9:13650857..13650876 60.07 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406427 Chr9:13632214..13632505 No primer for this exon
upstream ENSMUSE00000311609 Chr9:13633204..13633268 TCGGATTGCACATCCTATTG Chr9:13633209..13633228 59.5 45
upstream ENSMUSE00000366527 Chr9:13634169..13634223 No primer for this exon
upstream ENSMUSE00000311580 Chr9:13635426..13635581 CTTTTGATCGCAAGGAGGAA Chr9:13635550..13635569 60.32 45
upstream ENSMUSE00000338052 Chr9:13637416..13637615 GAAGTTGCTGTGCTGGCTCT Chr9:13637424..13637443 60.74 55
upstream ENSMUSE00000335929 Chr9:13640329..13640376 No primer for this exon
upstream ENSMUSE00000311477 Chr9:13640547..13640627 GAAAAAGCCCAAGTTGGAATC Chr9:13640586..13640606 59.94 42.86
upstream ENSMUSE00000311544 Chr9:13641281..13641416 GCAGATAGTGGGGGAACAGA Chr9:13641300..13641319 60.07 55
upstream ENSMUSE00000311526 Chr9:13644084..13644185 CAGTATGGAAAAAGCGCACA Chr9:13644143..13644162 59.87 45

*** Putative Vector Insertion (Chr 9: 13644186 - 13648472) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000340401 Chr9:13648473..13650973 AACAGGCTCATCGGAAAATG Chr9:13650857..13650876 60.07 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGATTTAATCGCCTTGCAG Chr9:13647231..13647251 59.32 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGATTCGTGACTGGGAAAAC Chr9:13647231..13647252 60.35 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037808