Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35167
Trapped Gene
Casq2 (ENSMUSG00000027861)
Vector Insertion
Chr 3: 101890796 - 101914162
Public Clones IST11193D2 (tigm) IST12522F12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000319115 (Chr3:101890465..101890795 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACGTACGATGGGAAAGACC Chr3:101890639..101890658 60.38 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000319115 (Chr3:101890465..101890795 +)
Downstram Exon
ENSMUSE00000319105 (Chr3:101914163..101914247 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACGTACGATGGGAAAGACC Chr3:101890639..101890658 60.38 55 CTCGAATCCACCATCACAAA Chr3:101914221..101914240 59.5 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000319115 Chr3:101890465..101890795 CACGTACGATGGGAAAGACC Chr3:101890639..101890658 60.38 55

*** Putative Vector Insertion (Chr 3: 101890796 - 101914162) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000319105 Chr3:101914163..101914247 CTCGAATCCACCATCACAAA Chr3:101914221..101914240 59.5 45
downstream ENSMUSE00000588110 Chr3:101916988..101917088 GAACTCCCCGTCAAACTCAA Chr3:101917058..101917077 60.09 50
downstream ENSMUSE00000406956 Chr3:101920787..101920898 TCACGATCTCCACTGGGTCT Chr3:101920817..101920836 60.68 55
downstream ENSMUSE00000173691 Chr3:101923840..101923913 TGCCTCTTGGAATGCTTTGT Chr3:101923865..101923884 60.78 45
downstream ENSMUSE00000173689 Chr3:101930472..101930602 ACGGTTTGTTAGGGATGACG Chr3:101930562..101930581 59.85 50
downstream ENSMUSE00000173693 Chr3:101931864..101931909 No primer for this exon
downstream ENSMUSE00000319051 Chr3:101937300..101937354 TGGATCCCATTCAAGTCGTC Chr3:101937325..101937344 60.87 50
downstream ENSMUSE00000319038 Chr3:101946103..101946203 GGGTCAATCCACAAGATGCT Chr3:101946190..101946209 59.93 50
downstream ENSMUSE00000588109 Chr3:101948077..101948151 ACATTCACCACCCCAATCTG Chr3:101948147..101948166 60.63 50
downstream ENSMUSE00000588108 Chr3:101949120..101950433 CCTTGGGCTGTCTGTATGGT Chr3:101949422..101949441 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr3:101899846..101899866 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGCTAGGTCTTGGGGGAAC Chr3:101890767..101890787 59.58 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027861