Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35168
Trapped Gene
Agbl2 (ENSMUSG00000040812)
Vector Insertion
Chr 2: 90622918 - 90623394
Public Clones IST14982F11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000643548 (Chr2:90622884..90622917 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGGGTCCTCGCAGAAAACTC Chr2:90622892..90622911 60.77 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000643548 (Chr2:90622884..90622917 +)
Downstram Exon
ENSMUSE00000454300 (Chr2:90623395..90623533 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGGGTCCTCGCAGAAAACTC Chr2:90622892..90622911 60.77 55 CACGCCTGGTCCACTAGATT Chr2:90623507..90623526 60.13 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000643548 Chr2:90622884..90622917 AGGGTCCTCGCAGAAAACTC Chr2:90622892..90622911 60.77 55

*** Putative Vector Insertion (Chr 2: 90622918 - 90623394) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000454300 Chr2:90623395..90623533 CACGCCTGGTCCACTAGATT Chr2:90623507..90623526 60.13 55
downstream ENSMUSE00000687995 Chr2:90623718..90623830 CCGTACCCAGCTGCAATATC Chr2:90623758..90623777 60.49 55
downstream ENSMUSE00000687991 Chr2:90623730..90623830 CCGTACCCAGCTGCAATATC Chr2:90623758..90623777 60.49 55
downstream ENSMUSE00000410908 Chr2:90623733..90623830 CCGTACCCAGCTGCAATATC Chr2:90623758..90623777 60.49 55
downstream ENSMUSE00000471382 Chr2:90624143..90624282 GCCATCTCAAGCAGGACATT Chr2:90624208..90624227 60.23 50
downstream ENSMUSE00000716640 Chr2:90624143..90624282 GCCATCTCAAGCAGGACATT Chr2:90624208..90624227 60.23 50
downstream ENSMUSE00000463586 Chr2:90624219..90624282 No primer for this exon
downstream ENSMUSE00000643545 Chr2:90629090..90629224 ACATGTACCGAGGGCTGTTC Chr2:90629161..90629180 60 55
downstream ENSMUSE00000643544 Chr2:90629936..90629989 GAGCATGCCCAGTTGAAGATA Chr2:90629970..90629990 60.23 47.62
downstream ENSMUSE00000643543 Chr2:90631617..90631802 AAGAGTTCTCGGGGTTCTCG Chr2:90631719..90631738 60.76 55
downstream ENSMUSE00000643542 Chr2:90634030..90634137 TCTCGCTTCCTGTAGGTTGG Chr2:90634083..90634102 60.39 55
downstream ENSMUSE00000643540 Chr2:90637593..90637746 AGATTCCCGCTCTCAAACCT Chr2:90637731..90637750 60.21 50
downstream ENSMUSE00000643539 Chr2:90641194..90641976 CTATCACGCCATCTGGGTTT Chr2:90641870..90641889 59.96 50
downstream ENSMUSE00000306553 Chr2:90643199..90643355 TGTCTGGTGCATTCTTGCTC Chr2:90643356..90643375 59.99 50
downstream ENSMUSE00000306534 Chr2:90645956..90646082 AGACCCGCCAAAGGTAGACT Chr2:90646078..90646097 60.13 55
downstream ENSMUSE00000306526 Chr2:90647456..90647556 TGGTTTGGTCAGGATCACAG Chr2:90647557..90647576 59.52 50
downstream ENSMUSE00000306520 Chr2:90648135..90648265 TGGATTCAATGTCAGACAAAGG Chr2:90648265..90648286 59.97 40.91
downstream ENSMUSE00000306512 Chr2:90650105..90650174 TGCAACGATGTTCAGTAGACG Chr2:90650170..90650190 59.92 47.62
downstream ENSMUSE00000306505 Chr2:90650798..90650920 ACTGCTCATTCCGCTGTTTT Chr2:90650873..90650892 59.88 45
downstream ENSMUSE00000391823 Chr2:90651414..90651521 TTGAGCCTTGGGTTTTCACT Chr2:90651520..90651539 59.71 45
downstream ENSMUSE00000335716 Chr2:90653432..90653509 TTCTTAGGGCTGGTCAGTGG Chr2:90653496..90653515 60.25 55
downstream ENSMUSE00000687987 Chr2:90654280..90654294 No primer for this exon
downstream ENSMUSE00000687997 Chr2:90654280..90654426 GTGAGGCTGCTATGCACTTG Chr2:90654382..90654401 59.62 55
downstream ENSMUSE00000643521 Chr2:90655497..90655670 TATGCAAGGATGGGTACACG Chr2:90655656..90655675 59.42 50
downstream ENSMUSE00000687990 Chr2:90655497..90656388 TCAGTGCCCTAGAGGTTTGG Chr2:90655777..90655796 60.25 55
downstream ENSMUSE00000453954 Chr2:90656421..90656531 GCTTGGTGCTCATGAAGGAT Chr2:90656473..90656492 60.23 50
downstream ENSMUSE00000453950 Chr2:90668267..90668645 CTTCCTCATCTGCCCAAAAG Chr2:90668413..90668432 59.81 50
downstream ENSMUSE00000687994 Chr2:90671552..90671692 TCCTGGAAAGGCTGATTCTG Chr2:90671666..90671685 60.33 50
downstream ENSMUSE00000687993 Chr2:90673626..90673720 AGCTGCAGTGCTCCTCTCTG Chr2:90673715..90673734 61.05 60
downstream ENSMUSE00000687992 Chr2:90674145..90674576 GAATATGCTTGTCGCCCAAT Chr2:90674199..90674218 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACTAATCGCCTTGCAGCAC Chr2:90622966..90622986 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCTCGCAGAAAACTCCAG Chr2:90622896..90622916 59.99 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040812