Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35169
Trapped Gene
Dlg2 (ENSMUSG00000052572)
Vector Insertion
Chr 7: 98598426 - 98859929
Public Clones IST13330H12 (tigm) IST10722H12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000500996 (Chr7:98598264..98598425 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTTGTGCATGTGTCGGAAA Chr7:98598341..98598360 60.16 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000500996 (Chr7:98598264..98598425 +)
Downstram Exon
ENSMUSE00000672367 (Chr7:98859930..98860308 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTTGTGCATGTGTCGGAAA Chr7:98598341..98598360 60.16 45 TAATTCTCAGCTCGGGAAGC Chr7:98860241..98860260 59.55 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000672371 Chr7:98239238..98239558 GCTGAATCCTCGGCTAATTG Chr7:98239267..98239286 59.81 50
upstream ENSMUSE00000672399 Chr7:98239517..98239558 GTGCACTCCGGACTAACGTA Chr7:98239536..98239555 58.8 55
upstream ENSMUSE00000500996 Chr7:98598264..98598425 ACTTGTGCATGTGTCGGAAA Chr7:98598341..98598360 60.16 45

*** Putative Vector Insertion (Chr 7: 98598426 - 98859929) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000672367 Chr7:98859930..98860308 TAATTCTCAGCTCGGGAAGC Chr7:98860241..98860260 59.55 50
downstream ENSMUSE00000519782 Chr7:98881601..98881654 No primer for this exon
downstream ENSMUSE00000520655 Chr7:98958989..98959039 No primer for this exon
downstream ENSMUSE00000514294 Chr7:99020886..99021010 ATATGCCAGGGTCATCTCCA Chr7:99020961..99020980 60.3 50
downstream ENSMUSE00000517822 Chr7:99049245..99049414 TCATTCACCCGCAAGATACA Chr7:99049277..99049296 60.07 45
downstream ENSMUSE00000496200 Chr7:99088509..99088645 CTGTGCAGCTCCACCATCTA Chr7:99088609..99088628 60.01 55
downstream ENSMUSE00000498266 Chr7:99114106..99114250 GTAATATCCGGTGGCCCATA Chr7:99114248..99114267 59.51 50
downstream ENSMUSE00000484426 Chr7:99116628..99116766 GTGCTTGGGAATTGGTGAGT Chr7:99116743..99116762 59.97 50
downstream ENSMUSE00000485354 Chr7:99145676..99145831 AATAGTGCCTGGGAGAAGCA Chr7:99145746..99145765 59.84 50
downstream ENSMUSE00000441920 Chr7:99189308..99189376 GCAGTACTGTGCTGGGAATG Chr7:99189331..99189350 59.32 55
downstream ENSMUSE00000672366 Chr7:99210904..99210969 CAGCTGCTTGGGAACTAGTGA Chr7:99210952..99210972 60.58 52.38
downstream ENSMUSE00000672365 Chr7:99214767..99214916 TGGCTCTATATGGGCTCTGG Chr7:99214864..99214883 60.19 55
downstream ENSMUSE00000491551 Chr7:99237072..99237228 ACTCAGGTCTGCTGGTCCAC Chr7:99237198..99237217 60.31 60
downstream ENSMUSE00000493673 Chr7:99275050..99275152 CTCCTCGAAGATCGATTCCA Chr7:99275077..99275096 60.29 50
downstream ENSMUSE00000456002 Chr7:99435001..99435115 GGAGCGTTTCTGATTGGTTC Chr7:99435107..99435126 59.68 50
downstream ENSMUSE00000455991 Chr7:99524064..99524240 AGTGTGACCCTTCTGGCTTG Chr7:99524198..99524217 60.3 55
downstream ENSMUSE00000455984 Chr7:99535425..99535500 TCACACCAGGTTTTGCATTG Chr7:99535489..99535508 60.55 45
downstream ENSMUSE00000633671 Chr7:99565734..99565833 GGATCACTGGTTTCCTGCTC Chr7:99565831..99565850 59.66 55
downstream ENSMUSE00000455976 Chr7:99566598..99566643 TTGTTCCATAACCGTCGTCA Chr7:99566637..99566656 59.96 45
downstream ENSMUSE00000633670 Chr7:99569142..99569183 CGCTGGCATTAGAAGAGACG Chr7:99569168..99569187 61.06 55
downstream ENSMUSE00000455973 Chr7:99576201..99576251 TGCCTCGTGACAGGTTCATA Chr7:99576249..99576268 60.26 50
downstream ENSMUSE00000455966 Chr7:99577067..99577168 No primer for this exon
downstream ENSMUSE00000455962 Chr7:99579507..99579679 TCGACTTCGTAGTCACGCTTT Chr7:99579542..99579562 60.07 47.62
downstream ENSMUSE00000455957 Chr7:99586475..99586584 ATGGCAATGGGATAGAGCTG Chr7:99586554..99586573 60.06 50
downstream ENSMUSE00000455952 Chr7:99591114..99591205 TTTAATCGCCCGGTCATAAG Chr7:99591177..99591196 59.92 45
downstream ENSMUSE00000464440 Chr7:99593021..99595513 TTTCCCTTTCGATCATTTGC Chr7:99594193..99594212 60.02 40
downstream ENSMUSE00000672373 Chr7:99593021..99597599 TTTCCCTTTCGATCATTTGC Chr7:99594193..99594212 60.02 40

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCATTGCTTCTCATCTTGTCC Chr7:98691446..98691467 59.83 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCATTGCTTCTCATCTTGTCC Chr7:98691446..98691467 59.83 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000052572