Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35171
Trapped Gene
Nfix (ENSMUSG00000001911)
Vector Insertion
Chr 8: 87251803 - 87296215
Public Clones IST11854C1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 45% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000606642 (Chr8:87295683..87296214 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000606642 (Chr8:87295683..87296214 -)
Downstram Exon
ENSMUSE00000264489 (Chr8:87251804..87251866 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639011 Chr8:87323897..87324239 No primer for this exon
upstream ENSMUSE00000606643 Chr8:87297253..87297295 No primer for this exon
upstream ENSMUSE00000681507 Chr8:87297253..87298268 No primer for this exon
upstream ENSMUSE00000720377 Chr8:87297253..87298268 No primer for this exon
upstream ENSMUSE00000415727 Chr8:87295683..87296238 No primer for this exon
upstream ENSMUSE00000606642 Chr8:87295683..87296214 No primer for this exon
upstream ENSMUSE00000264489 Chr8:87251804..87251866 No primer for this exon

*** Putative Vector Insertion (Chr 8: 87251803 - 87296215) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000264456 Chr8:87251504..87251578 No primer for this exon
downstream ENSMUSE00000264432 Chr8:87251023..87251143 No primer for this exon
downstream ENSMUSE00000338152 Chr8:87250368..87250504 No primer for this exon
downstream ENSMUSE00000681499 Chr8:87250368..87250501 No primer for this exon
downstream ENSMUSE00000211773 Chr8:87247627..87247749 No primer for this exon
downstream ENSMUSE00000211774 Chr8:87245542..87245717 No primer for this exon
downstream ENSMUSE00000415416 Chr8:87240040..87240187 No primer for this exon
downstream ENSMUSE00000606639 Chr8:87237665..87237756 No primer for this exon
downstream ENSMUSE00000606641 Chr8:87237665..87237756 No primer for this exon
downstream ENSMUSE00000681506 Chr8:87237604..87237610 No primer for this exon
downstream ENSMUSE00000681505 Chr8:87237335..87237339 No primer for this exon
downstream ENSMUSE00000606638 Chr8:87232525..87232576 No primer for this exon
downstream ENSMUSE00000635598 Chr8:87231498..87232576 No primer for this exon
downstream ENSMUSE00000681502 Chr8:87231498..87232576 No primer for this exon
downstream ENSMUSE00000681511 Chr8:87228611..87232576 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGCTTCCAGTGTTTCTGC Chr8:87293170..87293190 60.97 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGACGTGACTGGGAAAAC Chr8:87293149..87293169 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000001911