Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35175
Trapped Gene
Dus3l (ENSMUSG00000007603)
Vector Insertion
Chr 17: 56905216 - 56906204
Public Clones IST14735G1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000139695 (Chr17:56904948..56905215 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000139695 (Chr17:56904948..56905215 +)
Downstram Exon
ENSMUSE00000139697 (Chr17:56906205..56906711 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000285837 Chr17:56904201..56904364 No primer for this exon
upstream ENSMUSE00000139695 Chr17:56904948..56905215 No primer for this exon

*** Putative Vector Insertion (Chr 17: 56905216 - 56906204) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139697 Chr17:56906205..56906711 No primer for this exon
downstream ENSMUSE00000657115 Chr17:56907056..56907097 No primer for this exon
downstream ENSMUSE00000139687 Chr17:56907206..56907358 No primer for this exon
downstream ENSMUSE00000139691 Chr17:56907457..56907573 No primer for this exon
downstream ENSMUSE00000139682 Chr17:56907771..56907836 No primer for this exon
downstream ENSMUSE00000139678 Chr17:56907941..56908051 No primer for this exon
downstream ENSMUSE00000285635 Chr17:56908229..56908325 No primer for this exon
downstream ENSMUSE00000139690 Chr17:56908473..56908548 No primer for this exon
downstream ENSMUSE00000139679 Chr17:56908673..56908861 No primer for this exon
downstream ENSMUSE00000139688 Chr17:56908957..56909085 No primer for this exon
downstream ENSMUSE00000467671 Chr17:56909159..56909263 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGCCAGCACACTACGACA Chr17:56905168..56905188 60.06 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCCAGCACACTACGACA Chr17:56905168..56905188 60.06 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007603