Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35187
Trapped Gene
Mettl5 (ENSMUSG00000051730)
Vector Insertion
Chr 2: 69711940 - 69717242
Public Clones IST11680H4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 78% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000333101 (Chr2:69717159..69717241 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAGACTGCTTTGGGAATGG Chr2:69717203..69717222 59.67 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000333101 (Chr2:69717159..69717241 -)
Downstram Exon
ENSMUSE00000690974 (Chr2:69711941..69711992 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAGACTGCTTTGGGAATGG Chr2:69717203..69717222 59.67 50 TGACTTTCCATTCAGCAGCTT Chr2:69711937..69711957 60.01 42.86

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000644731 Chr2:69723306..69723654 GAGGCATACGAGTGCTTTCC Chr2:69723612..69723631 59.84 55
upstream ENSMUSE00000690970 Chr2:69723306..69723661 GAGGCATACGAGTGCTTTCC Chr2:69723612..69723631 59.84 55
upstream ENSMUSE00000372008 Chr2:69719354..69719468 ATTGAAAACAAAGCGGTTGC Chr2:69719411..69719430 60.12 40
upstream ENSMUSE00000414234 Chr2:69718824..69719005 CTCCCTTTGGGACCAAAAAT Chr2:69718831..69718850 60.16 45
upstream ENSMUSE00000333101 Chr2:69717159..69717241 GAAGACTGCTTTGGGAATGG Chr2:69717203..69717222 59.67 50
upstream ENSMUSE00000690969 Chr2:69715805..69717241 AACTCAGACCCACCATCAGG Chr2:69716843..69716862 59.96 55
upstream ENSMUSE00000690974 Chr2:69711941..69711992 GCTGCTGAATGGAAAGTCAA Chr2:69711958..69711977 59 45

*** Putative Vector Insertion (Chr 2: 69711940 - 69717242) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000690972 Chr2:69709789..69709838 No primer for this exon
downstream ENSMUSE00000690971 Chr2:69709271..69709373 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGACTGCTTTGGGAATGG Chr2:69717201..69717221 59.67 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTTGGGAATGGCAAGAACA Chr2:69717193..69717213 61 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000051730