Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35212
Trapped Gene
C85492 (ENSMUSG00000066235)
Vector Insertion
Chr 9: 121890728 - 121905132
Public Clones (sanger) (sanger) IST14618A10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000633458 (Chr9:121904994..121905131 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACTAGGAACACCTGCGACA Chr9:121905080..121905099 59.9 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000633458 (Chr9:121904994..121905131 -)
Downstram Exon
ENSMUSE00000528102 (Chr9:121890729..121892941 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACTAGGAACACCTGCGACA Chr9:121905080..121905099 59.9 55 TGAGGTTATCGGGGTTGAAG Chr9:121892317..121892336 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000633458 Chr9:121904994..121905131 CACTAGGAACACCTGCGACA Chr9:121905080..121905099 59.9 55
upstream ENSMUSE00000528102 Chr9:121890729..121892941 TTCCCTTACGCTGTCAATCC Chr9:121891720..121891739 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGGAACACCTGCGTAATCG Chr9:121905075..121905095 58.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTCTGGGGTTGTAGTTCG Chr9:121905103..121905123 59.06 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000066235