Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35217
Trapped Gene
Krt42 (ENSMUSG00000053654)
Vector Insertion
Chr 11: 100126242 - 100127076
Public Clones IST13069E1 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000462189 (Chr11:100126914..100127075 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGAGATGCGGGATCAGTAT Chr11:100126968..100126987 59.54 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000462189 (Chr11:100126914..100127075 -)
Downstram Exon
ENSMUSE00000112614 (Chr11:100126243..100126368 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGAGATGCGGGATCAGTAT Chr11:100126968..100126987 59.54 50 GGAGCTCCGTGATCTCTGTC Chr11:100126271..100126290 59.95 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000480613 Chr11:100130724..100131185 CAGTTTTGGTGTGTCGGATG Chr11:100130924..100130943 60 50
upstream ENSMUSE00000479535 Chr11:100128514..100128596 TCGTGCTGCAGATTGACAAC Chr11:100128546..100128565 61.03 50
upstream ENSMUSE00000482447 Chr11:100128249..100128405 GAGCTGGCCTATCTGAGGAA Chr11:100128262..100128281 59.53 55
upstream ENSMUSE00000462189 Chr11:100126914..100127075 ACGAGATGCGGGATCAGTAT Chr11:100126968..100126987 59.54 50
upstream ENSMUSE00000673010 Chr11:100126914..100127292 TGGAATCCACAGTCCAATGA Chr11:100127211..100127230 59.89 45
upstream ENSMUSE00000112614 Chr11:100126243..100126368 AGGAGCTGAACCGAGAAGTG Chr11:100126345..100126364 59.6 55

*** Putative Vector Insertion (Chr 11: 100126242 - 100127076) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000439991 Chr11:100125792..100126012 CTCCAGTCGGGTCTTCACAT Chr11:100125817..100125836 60.11 55
downstream ENSMUSE00000439986 Chr11:100124608..100124657 GCCAGGGATGAGGAGTATTG Chr11:100124606..100124625 59.51 55
downstream ENSMUSE00000381420 Chr11:100124202..100124481 TGGGCTATCATACGCAGACA Chr11:100124336..100124355 60.24 50
downstream ENSMUSE00000673009 Chr11:100124196..100124481 TGGGCTATCATACGCAGACA Chr11:100124336..100124355 60.24 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000053654