Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35218
Trapped Gene
Gm749 (ENSMUSG00000024224)
Vector Insertion
Chr 17: 28686549 - 28687600
Public Clones IST13517F6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 29% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000610028 (Chr17:28686430..28686548 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CATCATGGCATTCACTCAGG Chr17:28686455..28686474 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000610028 (Chr17:28686430..28686548 +)
Downstram Exon
ENSMUSE00000241057 (Chr17:28687601..28687723 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CATCATGGCATTCACTCAGG Chr17:28686455..28686474 60.07 50 TCCGCTTCTCTCCAGGTCTA Chr17:28687678..28687697 60.09 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610028 Chr17:28686430..28686548 CATCATGGCATTCACTCAGG Chr17:28686455..28686474 60.07 50

*** Putative Vector Insertion (Chr 17: 28686549 - 28687600) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000241057 Chr17:28687601..28687723 TCCGCTTCTCTCCAGGTCTA Chr17:28687678..28687697 60.09 55
downstream ENSMUSE00000139974 Chr17:28689360..28689563 AGGAGTCGATGTGGAGTTGG Chr17:28689545..28689564 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCACACAGACACAGTGAA Chr17:28686512..28686532 59.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCACACAGACACAGTGAA Chr17:28686512..28686532 59.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024224