Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35220
Trapped Gene
CN716893 (ENSMUSG00000035427)
Vector Insertion
Chr X: 83501466 - 83550433
Public Clones IST13422G5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000623174 (ChrX:83550341..83550432 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGGAATTTCGCTTAGCAAT ChrX:83550345..83550364 60.41 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000623174 (ChrX:83550341..83550432 -)
Downstram Exon
ENSMUSE00000697594 (ChrX:83501467..83501558 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGGAATTTCGCTTAGCAAT ChrX:83550345..83550364 60.41 45 AGCTTCTCCTCCACCTCCTC ChrX:83501508..83501527 59.95 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000623174 ChrX:83550341..83550432 GGGGAATTTCGCTTAGCAAT ChrX:83550345..83550364 60.41 45
upstream ENSMUSE00000697594 ChrX:83501467..83501558 GGGGAATTTCGCTTAGCAAT ChrX:83501471..83501490 60.41 45

*** Putative Vector Insertion (Chr X: 83501466 - 83550433) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000623173 ChrX:83500679..83500760 AAGTTGGCAACCACAGTTGG ChrX:83500684..83500703 60.98 50
downstream ENSMUSE00000697590 ChrX:83495595..83497821 CCAGGACTGCCTACAGCTTC ChrX:83496759..83496778 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAGACCACCCTGGGTCCAC ChrX:83535402..83535422 61.03 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATAGACCACCCTGGGTCCAC ChrX:83535402..83535422 61.03 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035427