Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35231
Trapped Gene
Edil3 (ENSMUSG00000034488)
Vector Insertion
Chr 13: 89429180 - 89459275
Public Clones IST11130B4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000229585 (Chr13:89429024..89429179 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGGTCACGTGCAGTTTGTT Chr13:89429082..89429101 60.2 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000229585 (Chr13:89429024..89429179 +)
Downstram Exon
ENSMUSE00000412574 (Chr13:89459276..89462830 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGGTCACGTGCAGTTTGTT Chr13:89429082..89429101 60.2 45 AAGCACCCTTGTGGACAAAC Chr13:89461584..89461603 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718055 Chr13:88961077..88961653 TCTCGCTTCATTGTTCTCCA Chr13:88961156..88961175 59.52 45
upstream ENSMUSE00000402542 Chr13:88961116..88961653 TCTCGCTTCATTGTTCTCCA Chr13:88961156..88961175 59.52 45
upstream ENSMUSE00000229659 Chr13:89084425..89084553 TGGCTGATGATTCCTTTTCC Chr13:89084479..89084498 60.01 45
upstream ENSMUSE00000229649 Chr13:89117360..89117389 No primer for this exon
upstream ENSMUSE00000229639 Chr13:89182037..89182165 TAAGCGAAGCCTATCGAGGA Chr13:89182082..89182101 60.07 50
upstream ENSMUSE00000229630 Chr13:89234156..89234269 GCAGAAATGGCGGAATATGT Chr13:89234183..89234202 59.93 45
upstream ENSMUSE00000229622 Chr13:89271279..89271460 TCACCGAGCTCTTTTTGGAC Chr13:89271346..89271365 60.38 50
upstream ENSMUSE00000229613 Chr13:89316750..89316905 AAGGATTGGAAGCCCAGAGT Chr13:89316803..89316822 60.07 50
upstream ENSMUSE00000229604 Chr13:89319841..89319985 CCCCCAATCAAAGCTCAGTA Chr13:89319892..89319911 60.07 50
upstream ENSMUSE00000229597 Chr13:89324284..89324468 GCCATAACGACCAGTCACAA Chr13:89324440..89324459 59.57 50
upstream ENSMUSE00000708388 Chr13:89339070..89340143 CATGTGATAGGGGTTGCACA Chr13:89339277..89339296 60.39 50
upstream ENSMUSE00000229585 Chr13:89429024..89429179 TTGGTCACGTGCAGTTTGTT Chr13:89429082..89429101 60.2 45

*** Putative Vector Insertion (Chr 13: 89429180 - 89459275) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000412574 Chr13:89459276..89462830 AAGCACCCTTGTGGACAAAC Chr13:89461584..89461603 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTATAATCGCCTTGCAGCAC Chr13:89429227..89429248 60.24 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACAAGGTGAACCCGTGACT Chr13:89429218..89429238 59.47 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034488