Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35236
Trapped Gene
Osbpl5 (ENSMUSG00000037606)
Vector Insertion
Chr 7: 150901570 - 150926247
Public Clones IST11129G11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000721097 (Chr7:150926175..150926246 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCCCAGCACTGAGTACAAC Chr7:150926182..150926201 60.72 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000721097 (Chr7:150926175..150926246 -)
Downstram Exon
ENSMUSE00000525858 (Chr7:150901571..150901727 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCCCAGCACTGAGTACAAC Chr7:150926182..150926201 60.72 60 GTGATGGGACCAAGCTCATT Chr7:150901554..150901573 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000710717 Chr7:150927578..150927868 TCCCTCAAGGACTGGCTCTA Chr7:150927795..150927814 59.94 55
upstream ENSMUSE00000721552 Chr7:150927578..150927868 TCCCTCAAGGACTGGCTCTA Chr7:150927795..150927814 59.94 55
upstream ENSMUSE00000721097 Chr7:150926175..150926246 GCCCCAGCACTGAGTACAAC Chr7:150926182..150926201 60.72 60
upstream ENSMUSE00000525858 Chr7:150901571..150901727 CTGCGAAAATGAGCTTGGTC Chr7:150901583..150901602 60.91 50

*** Putative Vector Insertion (Chr 7: 150901570 - 150926247) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000222602 Chr7:150899401..150899483 GGCTCTTCATCTCTGGGTTG Chr7:150899413..150899432 59.8 55
downstream ENSMUSE00000586647 Chr7:150895678..150895758 AGAGCATCCTTCTTGGAGACC Chr7:150895660..150895680 59.83 52.38
downstream ENSMUSE00000586646 Chr7:150895444..150895545 TCAGCCATGATGACCACACT Chr7:150895432..150895451 60.12 50
downstream ENSMUSE00000586645 Chr7:150894913..150895116 AGCTTCGTCCAGCTCTTCAG Chr7:150895063..150895082 59.89 55
downstream ENSMUSE00000586644 Chr7:150893251..150893335 GGCCCTGAAGATCAGGTAGC Chr7:150893245..150893264 61.13 60
downstream ENSMUSE00000586643 Chr7:150890874..150891045 GTGGGCAGTCCGTAGAGAGA Chr7:150890885..150890904 60.41 60
downstream ENSMUSE00000586642 Chr7:150890415..150890607 GAATGCATCGTTCTCCAAGG Chr7:150890552..150890571 60.6 50
downstream ENSMUSE00000586641 Chr7:150889056..150889240 GAGAGCAGGTCTCCGTGGTA Chr7:150889037..150889056 60.41 60
downstream ENSMUSE00000631611 Chr7:150888595..150888676 GCAGTAGGGGTCATCCTCTG Chr7:150888627..150888646 59.68 60
downstream ENSMUSE00000631610 Chr7:150887097..150887195 CTCCCCCAGAATGGGATTAT Chr7:150887138..150887157 59.97 50
downstream ENSMUSE00000631609 Chr7:150886619..150886715 CAGACACAGGAGGATGGTGA Chr7:150886669..150886688 59.66 55
downstream ENSMUSE00000631608 Chr7:150885139..150885237 TCCTCCTTGCGATTAAGGAA Chr7:150885152..150885171 59.78 45
downstream ENSMUSE00000525844 Chr7:150881475..150881517 GTCATGGTGCCGTAGAGGAT Chr7:150881474..150881493 59.96 55
downstream ENSMUSE00000491258 Chr7:150881420..150881517 GTCATGGTGCCGTAGAGGAT Chr7:150881474..150881493 59.96 55
downstream ENSMUSE00000493383 Chr7:150880945..150881034 CCGGAAATCTGGTTGATGTT Chr7:150880972..150880991 59.79 45
downstream ENSMUSE00000631607 Chr7:150880714..150880850 CCTCACTCGGAGTCCAGAAG Chr7:150880762..150880781 59.98 60
downstream ENSMUSE00000667953 Chr7:150880714..150880845 CCTCACTCGGAGTCCAGAAG Chr7:150880762..150880781 59.98 60
downstream ENSMUSE00000631606 Chr7:150880103..150880288 CTCATATCGGTAGCGCCATT Chr7:150880083..150880102 60.08 50
downstream ENSMUSE00000631605 Chr7:150879677..150879803 GGACTCCCCAGAAAGGTTGT Chr7:150879671..150879690 60.35 55
downstream ENSMUSE00000631604 Chr7:150878763..150878889 TGCTCTCAGTGACCTGGCTA Chr7:150878795..150878814 59.73 55
downstream ENSMUSE00000631603 Chr7:150877793..150877895 AGCTCTTGCTGAGCTTCCTG Chr7:150877777..150877796 60.03 55
downstream ENSMUSE00000514029 Chr7:150874667..150875862 CTCCTGGCAACCTCACTCTC Chr7:150875293..150875312 59.99 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAGCACAGTGGAAGCTACA Chr7:150926223..150926243 60.21 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAGCACAGTGGAAGCTACA Chr7:150926223..150926243 60.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037606