Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3524
Trapped Gene
Rprd1b (ENSMUSG00000027651)
Vector Insertion
Chr 2: 157861731 - 157861862
Public Clones BC0730 (sanger)
Private Clones OST430466 (lexicon)
Severity of mutation (?) Insertion after 22% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000171485 (Chr2:157861732..157861861 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTGCTTGTGGATGCTTTTT Chr2:157861829..157861848 59.32 40 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000171485 (Chr2:157861732..157861861 +)
Downstram Exon
ENSMUSE00000680612 (Chr2:157861732..157861861 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTGCTTGTGGATGCTTTTT Chr2:157861829..157861848 59.32 40 AAAAAGCATCCACAAGCACA Chr2:157861851..157861870 59.32 40

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661331 Chr2:157854231..157854781 TAAAGCGCATTTTCGGTGTT Chr2:157854264..157854283 60.62 40
upstream ENSMUSE00000639455 Chr2:157854261..157854781 TAAAGCGCATTTTCGGTGTT Chr2:157854264..157854283 60.62 40
upstream ENSMUSE00000383532 Chr2:157854437..157854781 GCTGTTACTGCGGAGACCTG Chr2:157854472..157854491 61 60

*** Putative Vector Insertion (Chr 2: 157861731 - 157861862) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171485 Chr2:157861732..157861861 AAAAAGCATCCACAAGCACA Chr2:157861851..157861870 59.32 40
downstream ENSMUSE00000680612 Chr2:157861732..157861861 AAAAAGCATCCACAAGCACA Chr2:157861851..157861870 59.32 40
downstream ENSMUSE00000333625 Chr2:157869142..157869275 TCGTTCTTGCCAGATGTTCA Chr2:157869205..157869224 60.39 45
downstream ENSMUSE00000680611 Chr2:157869142..157869275 TCGTTCTTGCCAGATGTTCA Chr2:157869205..157869224 60.39 45
downstream ENSMUSE00000386995 Chr2:157873652..157873764 TTGGGGAGAGTAGCTTCCAG Chr2:157873743..157873762 59.42 55
downstream ENSMUSE00000661330 Chr2:157873655..157873764 TTGGGGAGAGTAGCTTCCAG Chr2:157873743..157873762 59.42 55
downstream ENSMUSE00000316148 Chr2:157875823..157875949 CAGGGAAGCGATCTTCTGTC Chr2:157875909..157875928 59.95 55
downstream ENSMUSE00000404617 Chr2:157884388..157884563 GGGTGTATTCCACCAGCATC Chr2:157884522..157884541 60.2 55
downstream ENSMUSE00000680609 Chr2:157896192..157896245 CATTGACAAGCATGCACAGA Chr2:157896221..157896240 59.41 45
downstream ENSMUSE00000639454 Chr2:157896297..157896350 TGGAGCTGCTGAGTAAGACG Chr2:157896319..157896338 59.34 55
downstream ENSMUSE00000680613 Chr2:157896297..157896392 CAGGGCAGCTACCACATTTC Chr2:157896371..157896390 60.66 55
downstream ENSMUSE00000343617 Chr2:157900666..157903931 TAGGCAACAGCGAAAGGTCT Chr2:157900759..157900778 60.01 50
downstream ENSMUSE00000661329 Chr2:157900666..157903943 TAGGCAACAGCGAAAGGTCT Chr2:157900759..157900778 60.01 50
downstream ENSMUSE00000680614 Chr2:157956875..157956894 TCATGCCTCAGTTTCTGCAT Chr2:157956897..157956916 59.4 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCATTAATCGCCTTGCAG Chr2:157861776..157861796 59.83 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000027651