Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35265
Trapped Gene
4921513D23Rik (ENSMUSG00000060657)
Vector Insertion
Chr 16: 14128603 - 14128987
Public Clones IST10126D4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 68% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000621689 (Chr16:14128844..14128986 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGCAGGTCATCGTGAGAG Chr16:14128866..14128885 59.57 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000621689 (Chr16:14128844..14128986 -)
Downstram Exon
ENSMUSE00000621688 (Chr16:14128604..14128737 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGCAGGTCATCGTGAGAG Chr16:14128866..14128885 59.57 55 GTCGTCATCTTGTTGGGACA Chr16:14128607..14128626 59.53 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000704215 Chr16:14159237..14159367 CGGAGTCGGGAATCAAAATA Chr16:14159307..14159326 59.89 45
upstream ENSMUSE00000423422 Chr16:14153925..14154124 GGAACTGAGAACCCTTGCAG Chr16:14154034..14154053 59.84 55
upstream ENSMUSE00000563171 Chr16:14152119..14152805 GTGTTGTGGGAAGCTCCATT Chr16:14152355..14152374 59.97 50
upstream ENSMUSE00000482195 Chr16:14152051..14152796 GTGTTGTGGGAAGCTCCATT Chr16:14152355..14152374 59.97 50
upstream ENSMUSE00000423387 Chr16:14151235..14151409 AATGGCTGTGGAACAAAAGG Chr16:14151297..14151316 59.97 45
upstream ENSMUSE00000704210 Chr16:14151235..14151365 AATGGCTGTGGAACAAAAGG Chr16:14151297..14151316 59.97 45
upstream ENSMUSE00000704209 Chr16:14149114..14149335 TTGGCGTTTTCTGGGATATT Chr16:14149265..14149284 59.41 40
upstream ENSMUSE00000423380 Chr16:14149109..14149335 TTGGCGTTTTCTGGGATATT Chr16:14149265..14149284 59.41 40
upstream ENSMUSE00000423373 Chr16:14146817..14146934 CTGCAAAGAATGCTGCTGAT Chr16:14146890..14146909 59.18 45
upstream ENSMUSE00000423363 Chr16:14146010..14146182 CCCTCGGTTACCACTGAAGA Chr16:14146015..14146034 60.1 55
upstream ENSMUSE00000704208 Chr16:14146010..14146185 CCCTCGGTTACCACTGAAGA Chr16:14146015..14146034 60.1 55
upstream ENSMUSE00000423358 Chr16:14142325..14142750 GCCGACAAAGTGAAGTCTCC Chr16:14142464..14142483 59.85 55
upstream ENSMUSE00000261926 Chr16:14141981..14142138 GTGCCGAATGGAGTCAAAGT Chr16:14142114..14142133 60.12 50
upstream ENSMUSE00000563163 Chr16:14141736..14141894 TAAGCTACCCATCCGCATTC Chr16:14141798..14141817 60.06 50
upstream ENSMUSE00000621696 Chr16:14140276..14140438 GCTTTCAACATTGCCAATCC Chr16:14140406..14140425 60.46 45
upstream ENSMUSE00000704214 Chr16:14140276..14140465 GAGCCTCACCACTTGCTTTC Chr16:14140420..14140439 60 55
upstream ENSMUSE00000621695 Chr16:14138436..14138614 AAACCTGCACGAAGCAATCT Chr16:14138533..14138552 59.88 45
upstream ENSMUSE00000621694 Chr16:14137031..14137111 GCCTGTTGCTTGCCTCTCTT Chr16:14137058..14137077 61.99 55
upstream ENSMUSE00000621693 Chr16:14132663..14132899 ACTGCAGCCCAGTTCTGTTT Chr16:14132722..14132741 59.91 50
upstream ENSMUSE00000621692 Chr16:14132453..14132572 GTGTTCGCACCTCAAGTTCA Chr16:14132495..14132514 59.88 50
upstream ENSMUSE00000621691 Chr16:14131540..14131715 AGATTGCTATGCTGCGGAGT Chr16:14131690..14131709 60.01 50
upstream ENSMUSE00000621690 Chr16:14129739..14129959 ACCCTTGGCTTCTTCGTTCT Chr16:14129940..14129959 60.25 50
upstream ENSMUSE00000621689 Chr16:14128844..14128986 CAAGCAGGTCATCGTGAGAG Chr16:14128866..14128885 59.57 55
upstream ENSMUSE00000621688 Chr16:14128604..14128737 TGTCCCAACAAGATGACGAC Chr16:14128629..14128648 59.53 50

*** Putative Vector Insertion (Chr 16: 14128603 - 14128987) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000621687 Chr16:14127149..14127351 TGGCTTCCAAAAGTTCAAGC Chr16:14127144..14127163 60.37 45
downstream ENSMUSE00000470353 Chr16:14126035..14126262 CTTAACAAACTGGGCGGCTA Chr16:14126160..14126179 60.26 50
downstream ENSMUSE00000261841 Chr16:14120317..14120547 GACCAGCAACTGAGCAGTGA Chr16:14120445..14120464 60.19 55
downstream ENSMUSE00000261837 Chr16:14117376..14117588 GGGATGGCTCCCAGTAATTC Chr16:14117358..14117377 60.66 55
downstream ENSMUSE00000261830 Chr16:14116083..14116143 No primer for this exon
downstream ENSMUSE00000704211 Chr16:14115818..14115934 CTGTTCGGAGCTGGAGTTCT Chr16:14115796..14115815 59.6 55
downstream ENSMUSE00000261824 Chr16:14115812..14115934 AGTACCTGTTCGGAGCTGGA Chr16:14115791..14115810 59.87 55
downstream ENSMUSE00000261820 Chr16:14114276..14114446 TGGTCTTAGCTGAGGGGATG Chr16:14114318..14114337 60.21 55
downstream ENSMUSE00000621686 Chr16:14110626..14111864 TCAGACAGTTTTCCCCCATC Chr16:14111553..14111572 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGTCTGATGACCCTTACTCACA Chr16:14128942..14128964 60.17 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060657