Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35280
Trapped Gene
5033421C21Rik (ENSMUSG00000072731)
Vector Insertion
Chr 14: 7991737 - 8077222
Public Clones IST11068E9 (tigm) IST11068E9 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 17% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000651010 (Chr14:8077112..8077221 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000651010 (Chr14:8077112..8077221 -)
Downstram Exon
ENSMUSE00000651015 (Chr14:7991738..7991900 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AAGGTCCAGGATTCCACACA Chr14:7991742..7991761 60.36 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000651010 Chr14:8077112..8077221 No primer for this exon
upstream ENSMUSE00000651015 Chr14:7991738..7991900 GTGTGGAATCCTGGACCTTT Chr14:7991763..7991782 58.84 50

*** Putative Vector Insertion (Chr 14: 7991737 - 8077222) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000692895 Chr14:7990650..7990781 TGGAACCAATTATGGACTGGA Chr14:7990671..7990691 60.18 42.86
downstream ENSMUSE00000692893 Chr14:7977121..7977376 CAAGGGTCACCTTGGGTAAA Chr14:7977209..7977228 59.82 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGCCAGAGAACTCCGTGT Chr14:8023208..8023228 59.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAAGCCAGAGAACTCCGTGT Chr14:8023208..8023228 59.46 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072731