Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35284
Trapped Gene
AC068609.3 (ENSMUSG00000053178)
Vector Insertion
Chr 5: 4192419 - 4196366
Public Clones IST15095B10 (tigm) IST14330D9 (tigm) IST10901F5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000463798 (Chr5:4192360..4192418 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGCGGAAGTGAAAGGTGTCT Chr5:4192386..4192405 61.59 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000463798 (Chr5:4192360..4192418 +)
Downstram Exon
ENSMUSE00000702973 (Chr5:4196367..4196885 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGCGGAAGTGAAAGGTGTCT Chr5:4192386..4192405 61.59 55 GATCCCACCGTTTTGAAAGA Chr5:4196748..4196767 59.91 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000463798 Chr5:4192360..4192418 GGCGGAAGTGAAAGGTGTCT Chr5:4192386..4192405 61.59 55

*** Putative Vector Insertion (Chr 5: 4192419 - 4196366) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000473728 Chr5:4196336..4197652 GATCCCACCGTTTTGAAAGA Chr5:4196748..4196767 59.91 45
downstream ENSMUSE00000702973 Chr5:4196367..4196885 GATCCCACCGTTTTGAAAGA Chr5:4196748..4196767 59.91 45
downstream ENSMUSE00000702972 Chr5:4197322..4197333 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCGGAAGTGAAAGGTGTCT Chr5:4192387..4192407 61.59 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGCGGAAGTGAAAGGTGT Chr5:4195385..4195405 61.59 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000053178