Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35291
Trapped Gene
Abhd14b (ENSMUSG00000042073)
Vector Insertion
Chr 9: 106351041 - 106352334
Public Clones IST14481C12 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000583346 (Chr9:106350992..106351040 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AATAGCACACGCCATTCTCC Chr9:106350996..106351015 60.1 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000583346 (Chr9:106350992..106351040 +)
Downstram Exon
ENSMUSE00000353718 (Chr9:106352335..106352562 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AATAGCACACGCCATTCTCC Chr9:106350996..106351015 60.1 50 TACCCAGGTTCTGCCAAGTC Chr9:106352511..106352530 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000583346 Chr9:106350992..106351040 AATAGCACACGCCATTCTCC Chr9:106350996..106351015 60.1 50

*** Putative Vector Insertion (Chr 9: 106351041 - 106352334) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000353718 Chr9:106352335..106352562 TACCCAGGTTCTGCCAAGTC Chr9:106352511..106352530 60.11 55
downstream ENSMUSE00000691833 Chr9:106352753..106352790 GAAGGGAAGTGAGCCCAAAG Chr9:106352779..106352798 61.12 55
downstream ENSMUSE00000691832 Chr9:106353628..106353634 No primer for this exon
downstream ENSMUSE00000261762 Chr9:106353724..106353965 CACACTGGCGTAGTCCACAG Chr9:106353965..106353984 60.37 60
downstream ENSMUSE00000691831 Chr9:106353724..106353739 No primer for this exon
downstream ENSMUSE00000691830 Chr9:106353785..106353965 TTCACACTGGCGTAGTCCAC Chr9:106353967..106353986 59.75 55
downstream ENSMUSE00000345857 Chr9:106354315..106355246 AGCCCCTAAGGGAGATTTGA Chr9:106355124..106355143 60.03 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AATAGCACACGCCATTCTCC Chr9:106350997..106351017 60.1 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATAGCACACGCCATTCTCC Chr9:106350997..106351017 60.1 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000042073