Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35294
Trapped Gene
Armc3 (ENSMUSG00000037683)
Vector Insertion
Chr 2: 19222297 - 19225422
Public Clones IST12963C10 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700038 (Chr2:19222099..19222296 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAGTCGATACTGCCCATT Chr2:19222242..19222261 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700038 (Chr2:19222099..19222296 +)
Downstram Exon
ENSMUSE00000700037 (Chr2:19225423..19225585 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAGTCGATACTGCCCATT Chr2:19222242..19222261 59.96 50 TTACCGCCCATTTTATCTGC Chr2:19225452..19225471 59.93 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700053 Chr2:19120745..19120984 TCGCCTAGCAACAAACATCA Chr2:19120890..19120909 60.4 45
upstream ENSMUSE00000700052 Chr2:19123394..19123442 GTTGAACCTCCCCCTAAGGA Chr2:19123419..19123438 60.3 55
upstream ENSMUSE00000290542 Chr2:19157109..19157226 GCCTGCGAAGCCATCTATAA Chr2:19157193..19157212 60.33 50
upstream ENSMUSE00000290535 Chr2:19160268..19160393 AACTGCTCACCCACGAAGAC Chr2:19160322..19160341 60.31 55
upstream ENSMUSE00000290528 Chr2:19165576..19165644 No primer for this exon
upstream ENSMUSE00000290522 Chr2:19166170..19166345 TTGCGAACATGTCCGTAGAG Chr2:19166206..19166225 59.86 50
upstream ENSMUSE00000290516 Chr2:19170214..19170408 TCATCACGTGCGATAAGGAG Chr2:19170326..19170345 59.82 50
upstream ENSMUSE00000290509 Chr2:19175483..19175666 GCAGAGAGCTCCACAATTCC Chr2:19175597..19175616 59.96 55
upstream ENSMUSE00000290493 Chr2:19190700..19190852 GACAGCGATGGAACCAAGAT Chr2:19190765..19190784 60.08 50
upstream ENSMUSE00000290486 Chr2:19191652..19191757 CAATGAGGAGGTGAGGGAAG Chr2:19191686..19191705 59.65 55
upstream ENSMUSE00000290476 Chr2:19207514..19207763 GCGAGCTATCATCCAGAACC Chr2:19207631..19207650 59.8 55
upstream ENSMUSE00000290468 Chr2:19210452..19210588 TGCACTCCAAGAATGACGAG Chr2:19210492..19210511 59.98 50
upstream ENSMUSE00000290457 Chr2:19214609..19214777 TTTCCCTGAAATACAGCCAGA Chr2:19214701..19214721 59.69 42.86
upstream ENSMUSE00000290448 Chr2:19217016..19217113 CTGGCACCAAACTTTTGTCA Chr2:19217023..19217042 59.73 45
upstream ENSMUSE00000290439 Chr2:19217950..19218051 GTTGGCTATGGACGAAGCAT Chr2:19217987..19218006 60.1 50
upstream ENSMUSE00000378435 Chr2:19218431..19218538 AGCCAGCATCAGTACGGAAC Chr2:19218478..19218497 60.28 55
upstream ENSMUSE00000700044 Chr2:19218443..19218538 AGCCAGCATCAGTACGGAAC Chr2:19218478..19218497 60.28 55
upstream ENSMUSE00000700040 Chr2:19219533..19219580 No primer for this exon
upstream ENSMUSE00000700038 Chr2:19222099..19222296 CCAAGTCGATACTGCCCATT Chr2:19222242..19222261 59.96 50

*** Putative Vector Insertion (Chr 2: 19222297 - 19225422) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000700037 Chr2:19225423..19225585 TTACCGCCCATTTTATCTGC Chr2:19225452..19225471 59.93 45
downstream ENSMUSE00000700036 Chr2:19231544..19231861 ATCGGCTAAAGCCCCTCTTA Chr2:19231829..19231848 60.18 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATAATCGCCTTGCAGCACAT Chr2:19225347..19225367 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAGTGTAGTTTTCGTGACTGG Chr2:19225334..19225357 60.08 47.83 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037683