Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35296
Trapped Gene
B230317C12Rik (ENSMUSG00000036186)
Vector Insertion
Chr 2: 26490684 - 26491058
Public Clones IST12728A4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 37% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000233915 (Chr2:26490507..26490683 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCAAGGAGTTCCGGGAGAT Chr2:26490645..26490664 59.9 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000233915 (Chr2:26490507..26490683 +)
Downstram Exon
ENSMUSE00000491956 (Chr2:26491059..26492012 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCAAGGAGTTCCGGGAGAT Chr2:26490645..26490664 59.9 50 AAGATAGAGGTCCCCGCAGT Chr2:26491268..26491287 60.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000519152 Chr2:26484157..26484219 GGTGCACCTAGTGCTCCTCT Chr2:26484177..26484196 59.48 60
upstream ENSMUSE00000520037 Chr2:26488124..26488258 AGGCCTCAGGGTCAAGTATG Chr2:26488135..26488154 59.16 55
upstream ENSMUSE00000233920 Chr2:26490308..26490415 ATCATCTCCGGCTCTGTCTG Chr2:26490329..26490348 60.37 55
upstream ENSMUSE00000233915 Chr2:26490507..26490683 ATCAAGGAGTTCCGGGAGAT Chr2:26490645..26490664 59.9 50

*** Putative Vector Insertion (Chr 2: 26490684 - 26491058) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000491956 Chr2:26491059..26492012 AAGATAGAGGTCCCCGCAGT Chr2:26491268..26491287 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACCTTTACTGCAGCCCTCA Chr2:26490696..26490716 60.4 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATCAAGGAGTTCCGGGAGAT Chr2:26490646..26490666 59.9 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036186