Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3530
Trapped Gene
Spred1 (ENSMUSG00000027351)
Vector Insertion
Chr 2: 116946844 - 116947493
Public Clones BB0439 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000642403 (Chr2:116946845..116947492 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATCACGGTGAGGGAAAGATG Chr2:116947444..116947463 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000642403 (Chr2:116946845..116947492 +)
Downstram Exon
ENSMUSE00000685840 (Chr2:116947374..116947492 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATCACGGTGAGGGAAAGATG Chr2:116947444..116947463 59.93 50 CTCGCTCATCTTTCCCTCAC Chr2:116947472..116947491 59.95 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC

*** Putative Vector Insertion (Chr 2: 116946844 - 116947493) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000642403 Chr2:116946845..116947492 CTCGCTCATCTTTCCCTCAC Chr2:116947472..116947491 59.95 55
downstream ENSMUSE00000685840 Chr2:116947374..116947492 CTCGCTCATCTTTCCCTCAC Chr2:116947472..116947491 59.95 55
downstream ENSMUSE00000168672 Chr2:116978728..116978902 GGTAGCCATCCACCACTTGA Chr2:116978796..116978815 60.92 55
downstream ENSMUSE00000168674 Chr2:116989234..116989402 TCATCGATCTTCCAGTGGTG Chr2:116989316..116989335 59.63 50
downstream ENSMUSE00000168678 Chr2:116990682..116990731 TTCAGCCTCAGTTTTTGACG Chr2:116990713..116990732 59.05 45
downstream ENSMUSE00000295550 Chr2:116997664..116997822 GGGAACGGGAAGTGTCTTCT Chr2:116997694..116997713 60.49 55
downstream ENSMUSE00000685839 Chr2:116997664..116998590 TCACTAGGGAACGGGAAGTG Chr2:116997700..116997719 60.1 55
downstream ENSMUSE00000295540 Chr2:117001080..117001181 TGCCGCTGTACATATTCCAT Chr2:117001144..117001163 59.02 45
downstream ENSMUSE00000295535 Chr2:117003038..117006017 AGAACGTTCCCCATCCTCTT Chr2:117003352..117003371 59.94 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr2:116946894..116946914 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGTCCGTGACTGGGAAAAC Chr2:116946890..116946910 63.37 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027351