Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35307
Trapped Gene
AC158997.2 (ENSMUSG00000079469)
Vector Insertion
Chr 9: 72886429 - 72887459
Public Clones IST12411H11 (tigm) IST14353A11 (tigm) IST11748A4 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000635580 (Chr9:72887269..72887458 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGTCCAGGCAGTACGTGAGC Chr9:72887297..72887316 60.48 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000635580 (Chr9:72887269..72887458 -)
Downstram Exon
ENSMUSE00000531900 (Chr9:72886430..72886565 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGTCCAGGCAGTACGTGAGC Chr9:72887297..72887316 60.48 60 AGTATTCGCAGAGCGATGGT Chr9:72886489..72886508 59.87 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000635580 Chr9:72887269..72887458 AGTCCAGGCAGTACGTGAGC Chr9:72887297..72887316 60.48 60
upstream ENSMUSE00000531900 Chr9:72886430..72886565 ACCATCGCTCTGCGAATACT Chr9:72886511..72886530 59.87 50

*** Putative Vector Insertion (Chr 9: 72886429 - 72887459) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000307090 Chr9:72884511..72884628 CGAAGATGAGGGGGTAAGTG Chr9:72884542..72884561 59.54 55
downstream ENSMUSE00000307069 Chr9:72882294..72882398 TCCGCTACAGCAGACAGAAG Chr9:72882330..72882349 59.34 55
downstream ENSMUSE00000217659 Chr9:72879860..72879990 TGTGCAGCAGTACCATGTGA Chr9:72879924..72879943 59.89 50
downstream ENSMUSE00000217668 Chr9:72877373..72877513 CACCCATGGGATAAGAGCTG Chr9:72877425..72877444 60.47 55
downstream ENSMUSE00000217656 Chr9:72871036..72871087 No primer for this exon
downstream ENSMUSE00000217665 Chr9:72870082..72870293 CACGGTCAGCAGCAGTATGT Chr9:72870083..72870102 59.93 55
downstream ENSMUSE00000217666 Chr9:72869093..72869157 AATTCTTTGTGGCCCAACAT Chr9:72869115..72869134 59.29 40
downstream ENSMUSE00000217671 Chr9:72865677..72865890 GAATACTGAGGCCGAAGCTG Chr9:72865690..72865709 59.98 55
downstream ENSMUSE00000217650 Chr9:72865198..72865378 GTGACGCATTGCTGTGAAAT Chr9:72865214..72865233 59.73 45
downstream ENSMUSE00000511996 Chr9:72863956..72864102 GGGTAACCTTCGCTCGTAGA Chr9:72863964..72863983 59.34 55
downstream ENSMUSE00000706923 Chr9:72862474..72862857 TATTTGGAGAGGACGGGTTG Chr9:72862463..72862482 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCGCCTACAAGAAAGTGAGG Chr9:72887431..72887451 59.87 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGCCTACAAGAAAGTGAGG Chr9:72887431..72887451 59.87 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000079469