Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35325
Trapped Gene
A930001N09Rik (ENSMUSG00000048249)
Vector Insertion
Chr 17: 26873929 - 26876487
Public Clones IST11637D6 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000701238 (Chr17:26873734..26873928 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGTGGTGACCCAAGCAGTT Chr17:26873758..26873777 59.62 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000701238 (Chr17:26873734..26873928 +)
Downstram Exon
ENSMUSE00000139415 (Chr17:26876488..26876613 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGTGGTGACCCAAGCAGTT Chr17:26873758..26873777 59.62 50 AAAGGTGTGGCTTCGAAAGG Chr17:26876547..26876566 61.53 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000701239 Chr17:26852595..26852719 ACCCGTCAGGAAGGACATAA Chr17:26852615..26852634 59.4 50
upstream ENSMUSE00000701238 Chr17:26873734..26873928 AAGTGGTGACCCAAGCAGTT Chr17:26873758..26873777 59.62 50

*** Putative Vector Insertion (Chr 17: 26873929 - 26876487) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139415 Chr17:26876488..26876613 AAAGGTGTGGCTTCGAAAGG Chr17:26876547..26876566 61.53 50
downstream ENSMUSE00000139417 Chr17:26878987..26880076 GGGAATCGGAAACAGACTGA Chr17:26879314..26879333 60.05 50
downstream ENSMUSE00000407710 Chr17:26894750..26894944 ATTCCACTCAGAAGGCCTCA Chr17:26894898..26894917 59.8 50
downstream ENSMUSE00000373087 Chr17:26896705..26896894 GCGCAGCTCATTACCAATCT Chr17:26896799..26896818 60.38 50
downstream ENSMUSE00000343019 Chr17:26899183..26899256 GGCCCCACAACTTCACTTTA Chr17:26899244..26899263 59.97 50
downstream ENSMUSE00000403494 Chr17:26900271..26900393 CCATGCTGGGTTCTCTCTCT Chr17:26900360..26900379 59.4 55
downstream ENSMUSE00000657977 Chr17:26908237..26909832 CACCTAAGTGGCCACCAACT Chr17:26909513..26909532 60.03 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGATCTGGGCTTGGAAATG Chr17:26873904..26873924 61.35 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048249