Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35339
Trapped Gene
Hmcn2 (ENSMUSG00000055632)
Vector Insertion
Chr 2: 31309141 - 31310147
Public Clones IST14791D7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 28% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000345616 (Chr2:31308903..31309140 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTATCAGCTCGGCCTTTGAC Chr2:31309072..31309091 59.98 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000345616 (Chr2:31308903..31309140 +)
Downstram Exon
ENSMUSE00000381718 (Chr2:31310148..31310210 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTATCAGCTCGGCCTTTGAC Chr2:31309072..31309091 59.98 55 ACAAAATGCTCCCTGCACAT Chr2:31310209..31310228 60.53 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696086 Chr2:31169935..31170196 CCTTCGTCTTCGATGTCACC Chr2:31170056..31170075 60.66 55
upstream ENSMUSE00000696085 Chr2:31189375..31189445 GGCAGACCCAGTGGTATTTC Chr2:31189397..31189416 59.41 55
upstream ENSMUSE00000696084 Chr2:31190934..31191092 AGGTGATTGCCCAGAGATGA Chr2:31190939..31190958 60.62 50
upstream ENSMUSE00000696083 Chr2:31192027..31192149 CTGGCTACCTGGTCTTCGAG Chr2:31192070..31192089 60.01 60
upstream ENSMUSE00000696082 Chr2:31198576..31198747 CAGGGCCTGAGATTGAAGTC Chr2:31198715..31198734 59.8 55
upstream ENSMUSE00000696081 Chr2:31199532..31199638 GACTCAGCCAAGGTCGTAGC Chr2:31199582..31199601 60.02 60
upstream ENSMUSE00000696080 Chr2:31199989..31200109 CAGGCATCAGCAACATCAAC Chr2:31200023..31200042 60.27 50
upstream ENSMUSE00000696079 Chr2:31201982..31202245 ATCCCCTCCTTCGTGTCTCT Chr2:31202198..31202217 60.07 55
upstream ENSMUSE00000696078 Chr2:31205498..31205642 GTATAGCACCCTCCCCTTCC Chr2:31205571..31205590 59.79 60
upstream ENSMUSE00000696077 Chr2:31206039..31206160 TACCAGTGCATAGCCGTCAG Chr2:31206097..31206116 59.89 55
upstream ENSMUSE00000696076 Chr2:31208129..31208401 CCTTACCAGCCACAACAGGT Chr2:31208252..31208271 60.03 55
upstream ENSMUSE00000696075 Chr2:31209236..31209377 GTCAGCATCAATGCAAGGTC Chr2:31209247..31209266 59.25 50
upstream ENSMUSE00000696074 Chr2:31209686..31209813 TGAAGTTGGCACAGATGAGG Chr2:31209770..31209789 59.83 50
upstream ENSMUSE00000696073 Chr2:31210142..31210255 ATCCGTGTCTGCTGTCAATG Chr2:31210149..31210168 59.71 50
upstream ENSMUSE00000696072 Chr2:31211744..31211893 GACGCTGGCCTCTATACCTG Chr2:31211818..31211837 59.86 60
upstream ENSMUSE00000696070 Chr2:31216401..31216589 ACTGGACAGCGAGATTCAGG Chr2:31216553..31216572 60.41 55
upstream ENSMUSE00000696069 Chr2:31217317..31217412 GTGTGAAGCTCGCAATGTGT Chr2:31217348..31217367 59.91 50
upstream ENSMUSE00000696068 Chr2:31217678..31217805 AGATCGCCAACAGTGCTTCT Chr2:31217687..31217706 60.02 50
upstream ENSMUSE00000696067 Chr2:31219737..31219881 GAGATGTGGAGCTGGTGGTC Chr2:31219858..31219877 60.69 60
upstream ENSMUSE00000696066 Chr2:31224471..31224583 CACCCCTAAAATCACCTGGA Chr2:31224559..31224578 59.78 50
upstream ENSMUSE00000696065 Chr2:31224694..31224850 ACCAACGCCTTGACTACCAG Chr2:31224697..31224716 60.17 55
upstream ENSMUSE00000696064 Chr2:31226301..31226466 GTGACAGTCAAGGCTGGTGA Chr2:31226354..31226373 59.87 55
upstream ENSMUSE00000696063 Chr2:31233761..31233888 CCGCTACGTCCTCAGAGTTC Chr2:31233866..31233885 60.01 60
upstream ENSMUSE00000696062 Chr2:31235748..31236002 CAATAGCGCTGGCACAGATA Chr2:31235956..31235975 60 50
upstream ENSMUSE00000696061 Chr2:31236562..31236648 GGACTGACGAGACCAAGAGC Chr2:31236577..31236596 59.99 60
upstream ENSMUSE00000696060 Chr2:31237847..31238041 ACTCCAAAGCCACGAATCAC Chr2:31237849..31237868 60.12 50
upstream ENSMUSE00000696059 Chr2:31239170..31239334 CTGACGCTGGAGTGTGACAT Chr2:31239232..31239251 59.9 55
upstream ENSMUSE00000696058 Chr2:31239567..31239707 ATCCAAGAGAGCCATTCTGG Chr2:31239620..31239639 59.24 50
upstream ENSMUSE00000696057 Chr2:31240359..31240485 AGGTGGAGTGGACCAAGGAT Chr2:31240461..31240480 60.77 55
upstream ENSMUSE00000696056 Chr2:31240670..31240824 GCCAAGGACTTTCAGCTCAG Chr2:31240797..31240816 60.13 55
upstream ENSMUSE00000696055 Chr2:31242131..31242409 CCTGCAGGGATTACGAAGAA Chr2:31242367..31242386 60.21 50
upstream ENSMUSE00000696054 Chr2:31243687..31243965 ACCTACCATTGAGGGTGCTG Chr2:31243691..31243710 59.99 55
upstream ENSMUSE00000696053 Chr2:31244523..31244631 GGGACAGTCTCTGGATCTTCC Chr2:31244575..31244595 60.07 57.14
upstream ENSMUSE00000696052 Chr2:31244775..31244969 TGAACCACTCAGGCCTCTTT Chr2:31244864..31244883 59.84 50
upstream ENSMUSE00000696050 Chr2:31246460..31246637 CCCTTTCCTGCAACCTGTAA Chr2:31246503..31246522 60.1 50
upstream ENSMUSE00000696049 Chr2:31246935..31247046 CCAGATTGAGAAGGCAGACC Chr2:31246946..31246965 59.8 55
upstream ENSMUSE00000696048 Chr2:31247650..31247745 TGGTTCTGGAGAATGCCTCT Chr2:31247686..31247705 59.8 50
upstream ENSMUSE00000696047 Chr2:31248482..31248658 GAAGTATGGCCTACGGGTCA Chr2:31248636..31248655 59.96 55
upstream ENSMUSE00000696046 Chr2:31250209..31250366 GCCTGACCTGTAATGCCACT Chr2:31250272..31250291 60.14 55
upstream ENSMUSE00000696045 Chr2:31251541..31251664 CTCTGATTCGGGCAGCTACT Chr2:31251585..31251604 59.6 55
upstream ENSMUSE00000696044 Chr2:31252164..31252339 TGTCCGTCGTCGTAAATGAG Chr2:31252197..31252216 59.72 50
upstream ENSMUSE00000696043 Chr2:31252996..31253092 GCCGCTCTGAGAAACACTTC Chr2:31253057..31253076 60.14 55
upstream ENSMUSE00000696042 Chr2:31253209..31253328 CCAGACTGTCGTGTGACTGC Chr2:31253269..31253288 60.53 60
upstream ENSMUSE00000696041 Chr2:31254401..31254562 GCCCAGGAGGGGACATATAC Chr2:31254484..31254503 60.55 60
upstream ENSMUSE00000696040 Chr2:31255539..31255820 CCTCACAACAGTCTCCGTGA Chr2:31255570..31255589 59.86 55
upstream ENSMUSE00000696039 Chr2:31257120..31257287 TGCTACCTTACACGGCTCCT Chr2:31257166..31257185 59.9 55
upstream ENSMUSE00000696038 Chr2:31257932..31258045 GCTGGATGCTGAAGATGACC Chr2:31257935..31257954 60.78 55
upstream ENSMUSE00000696036 Chr2:31259173..31259259 TTCCTCCCAGCATTGAAAAT Chr2:31259173..31259192 59.51 40
upstream ENSMUSE00000696035 Chr2:31260234..31260425 ATGCTGGCCACTATTCTTGC Chr2:31260351..31260370 60.24 50
upstream ENSMUSE00000696034 Chr2:31261006..31261179 AATGCCAACGAGGAAGTGAC Chr2:31261038..31261057 60.12 50
upstream ENSMUSE00000696032 Chr2:31261301..31261414 CTGAATGCCCAGAAGGAAGA Chr2:31261321..31261340 60.33 50
upstream ENSMUSE00000696031 Chr2:31261901..31262043 AACAGCTCTCTGACCCTGGA Chr2:31261969..31261988 59.99 55
upstream ENSMUSE00000696030 Chr2:31262512..31262662 TCTGACTCTGGCCGATACCT Chr2:31262584..31262603 59.83 55
upstream ENSMUSE00000696029 Chr2:31264451..31264669 AGAAGATGGGCGATGTTGAT Chr2:31264466..31264485 59.51 45
upstream ENSMUSE00000696027 Chr2:31266769..31266882 GGCGAGGACTGGCTACATTA Chr2:31266846..31266865 60.24 55
upstream ENSMUSE00000696026 Chr2:31267241..31267428 CACCTGCTGTGTCATGGTTC Chr2:31267343..31267362 60.16 55
upstream ENSMUSE00000696025 Chr2:31267994..31268090 No primer for this exon
upstream ENSMUSE00000696024 Chr2:31268774..31268935 CTGGGACAAGAGGCTTTCCT Chr2:31268908..31268927 60.76 55
upstream ENSMUSE00000696022 Chr2:31269087..31269200 AGCTGACTCCGGGACCTACT Chr2:31269121..31269140 60.27 60
upstream ENSMUSE00000696021 Chr2:31270047..31270249 AGCGGATTCAGGGTCTACAA Chr2:31270197..31270216 59.69 50
upstream ENSMUSE00000696020 Chr2:31270721..31270802 No primer for this exon
upstream ENSMUSE00000696019 Chr2:31272230..31272361 AACATTTGAGAAGCCCGAGA Chr2:31272237..31272256 59.81 45
upstream ENSMUSE00000696018 Chr2:31275342..31275485 CAGGCCGGTACCTACACTTG Chr2:31275410..31275429 60.56 60
upstream ENSMUSE00000696017 Chr2:31275578..31275737 CAGCCACCACCAGATATAACC Chr2:31275667..31275687 59.33 52.38
upstream ENSMUSE00000696016 Chr2:31275818..31275942 CTATCTGGACGGCAGTACCC Chr2:31275821..31275840 59.57 60
upstream ENSMUSE00000696014 Chr2:31276293..31276476 CACCATCAAGCAACAAGCTG Chr2:31276300..31276319 60.45 50
upstream ENSMUSE00000696012 Chr2:31278123..31278220 ATTCAGGCGTCTTCACCTGT Chr2:31278146..31278165 59.73 50
upstream ENSMUSE00000696011 Chr2:31278610..31278876 CATCCTGGAACCAGTGGAGT Chr2:31278617..31278636 59.96 55
upstream ENSMUSE00000696010 Chr2:31279412..31279587 CCCCTCACATTGAGGAATCT Chr2:31279415..31279434 58.94 50
upstream ENSMUSE00000696009 Chr2:31279717..31279798 CCTGCAGGTGAAGTTGAGAA Chr2:31279756..31279775 59.01 50
upstream ENSMUSE00000696008 Chr2:31279886..31280022 AGATTGAGTGGCATCGAGGT Chr2:31279988..31280007 59.69 50
upstream ENSMUSE00000696007 Chr2:31280658..31280799 GATGCCCACACTCACTTTCC Chr2:31280661..31280680 60.52 55
upstream ENSMUSE00000696006 Chr2:31280874..31281018 ATCCAATCAGGACCGAACAC Chr2:31280885..31280904 59.79 50
upstream ENSMUSE00000696005 Chr2:31281665..31281792 GATGCCGGACACTACCTCTG Chr2:31281717..31281736 60.68 60
upstream ENSMUSE00000696004 Chr2:31282317..31282473 GGTGACCTGGTGGAAGGATG Chr2:31282414..31282433 62.72 60
upstream ENSMUSE00000696003 Chr2:31283708..31283829 GTGTCGTGAGCAATGAGGTG Chr2:31283773..31283792 60.32 55
upstream ENSMUSE00000695997 Chr2:31284475..31284639 ACGACCAGACACATTTCACG Chr2:31284493..31284512 59.6 50
upstream ENSMUSE00000695996 Chr2:31285859..31285966 CATGGTCCTCACAGTGCAAG Chr2:31285947..31285966 60.31 55
upstream ENSMUSE00000695995 Chr2:31286235..31286369 ATCTGGCAGAAGGAGGGTCT Chr2:31286336..31286355 60.22 55
upstream ENSMUSE00000695994 Chr2:31286602..31286736 CTACTTCTGCATTGCCCAGA Chr2:31286672..31286691 59.02 50
upstream ENSMUSE00000695991 Chr2:31287653..31287843 CCTGGTATCTGGAGCTGAGG Chr2:31287774..31287793 59.82 60
upstream ENSMUSE00000695990 Chr2:31288795..31289008 GCAGGCACTTACATCTGCAC Chr2:31288804..31288823 59.48 55
upstream ENSMUSE00000695989 Chr2:31290204..31290338 ACAGAGTTGGTCGTGTGCAG Chr2:31290294..31290313 59.94 55
upstream ENSMUSE00000695988 Chr2:31291231..31291421 CTACAGAACGGCTCCCTGAC Chr2:31291386..31291405 59.87 60
upstream ENSMUSE00000568062 Chr2:31293582..31293849 ATCCACCTTACACCCCTTCC Chr2:31293653..31293672 60.05 55
upstream ENSMUSE00000695987 Chr2:31293768..31293849 CCGTGAAGAAAGTGGTGACA Chr2:31293817..31293836 59.72 50
upstream ENSMUSE00000568060 Chr2:31300594..31300863 GTGACAGTGAGGTCCGGAGT Chr2:31300626..31300645 60.16 60
upstream ENSMUSE00000568057 Chr2:31306328..31306477 CTGGAGCAGCATCAGTCAAG Chr2:31306443..31306462 59.73 55
upstream ENSMUSE00000568050 Chr2:31306354..31306477 CTGGAGCAGCATCAGTCAAG Chr2:31306443..31306462 59.73 55
upstream ENSMUSE00000392789 Chr2:31308330..31308467 TGGCTAGAGAGAGCGGAGAG Chr2:31308381..31308400 59.99 60
upstream ENSMUSE00000389169 Chr2:31308563..31308684 AATGGCATGATCCCAGAGAG Chr2:31308637..31308656 60.03 50
upstream ENSMUSE00000345616 Chr2:31308903..31309140 CTATCAGCTCGGCCTTTGAC Chr2:31309072..31309091 59.98 55

*** Putative Vector Insertion (Chr 2: 31309141 - 31310147) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000381718 Chr2:31310148..31310210 ACAAAATGCTCCCTGCACAT Chr2:31310209..31310228 60.53 45
downstream ENSMUSE00000338864 Chr2:31310325..31310447 AGGAGCAGGAGAAATGACCA Chr2:31310405..31310424 59.8 50
downstream ENSMUSE00000373886 Chr2:31311012..31311146 CTTCACAGTTGCTTCCGTCA Chr2:31311149..31311168 60.03 50
downstream ENSMUSE00000372865 Chr2:31312580..31312708 CCACCTGGAGTGTTCTCACA Chr2:31312652..31312671 59.71 55
downstream ENSMUSE00000407803 Chr2:31313253..31313573 CCATCCCGTAGGAGAGTCTG Chr2:31313364..31313383 59.67 60
downstream ENSMUSE00000376387 Chr2:31314204..31314323 GAGGGGCACAGGCAATAGTA Chr2:31314288..31314307 60.1 55
downstream ENSMUSE00000368377 Chr2:31314601..31314727 ACACTCGATGCCATCTTCCT Chr2:31314638..31314657 59.69 50
downstream ENSMUSE00000500614 Chr2:31315570..31316234 CTGTTCCTCTCTGCGAGGTC Chr2:31315961..31315980 60.13 60
downstream ENSMUSE00000504441 Chr2:31315570..31315768 GCGGTACTGCAGTGTAGACG Chr2:31315636..31315655 59.54 60
downstream ENSMUSE00000476669 Chr2:31315771..31316118 GTTCCTCTCTGCGAGGTCAG Chr2:31315959..31315978 60.13 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGACGGCCAGAGTTAATCG Chr2:31309178..31309198 59.34 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCCTGAACTTCCAGCTTAC Chr2:31309105..31309125 58.94 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000055632