Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35351
Trapped Gene
EG328280 (ENSMUSG00000058246)
Vector Insertion
Chr 13: 67934809 - 67943932
Public Clones IST11285F8 (tigm) IST14897F11 (tigm) IST14897F11 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 64% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000510598 (Chr13:67934732..67934808 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGCTGGTGACATTTCTGGA Chr13:67934752..67934771 59.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000510598 (Chr13:67934732..67934808 +)
Downstram Exon
ENSMUSE00000641315 (Chr13:67943933..67943947 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGCTGGTGACATTTCTGGA Chr13:67934752..67934771 59.83 50 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641316 Chr13:67934172..67934295 CCTGCTCAGTGGCATCTGTA Chr13:67934232..67934251 60.01 55
upstream ENSMUSE00000510598 Chr13:67934732..67934808 CAGCTGGTGACATTTCTGGA Chr13:67934752..67934771 59.83 50

*** Putative Vector Insertion (Chr 13: 67934809 - 67943932) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000641315 Chr13:67943933..67943947 No primer for this exon
downstream ENSMUSE00000511622 Chr13:67943949..67944050 ACCATCAGGCATTCCAGTTC Chr13:67944014..67944033 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GATGACACACCACCACCCTA Chr13:67940828..67940848 59.23 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GATGACACACCACCACCCTA Chr13:67940828..67940848 59.23 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058246