Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI3537
Trapped Gene
Mark2 (ENSMUSG00000024969)
Vector Insertion
Chr 19: 7369928 - 7415657
Public Clones AZ0405 (sanger) (sanger) (sanger) (sanger) (sanger) AQ0140 (sanger)
(sanger) (sanger) (sanger) XL799 (baygenomics) 3SP141H04 (ggtc)
(ggtc) D043B02 (ggtc) 3SP151H02 (ggtc) 3SE065H04 (ggtc) (ggtc)
5SP143D01 (ggtc) 5SD081H09 (ggtc) 5SD069E02 (ggtc) (ggtc)
P141H04 (ggtc) 5SP147C08 (ggtc) 3SD142F05 (ggtc) 5SP141H04 (ggtc)
3SD081H09 (ggtc) D069E02 (ggtc) 5SE286C04 (ggtc) 3SD069E02 (ggtc)
(ggtc) 3SP147C08 (ggtc) 3SD141H03 (ggtc) Ayu21-T218 (egtc) IST14497B11 (tigm)
IST14956H10 (tigm) IST14370B1 (tigm) IST14377F1 (tigm) IST14170D9 (tigm)
IST10036E5 (tigm) IST14114D5 (tigm) IST14486A12 (tigm) IST14567C11 (tigm)
IST13573B4 (tigm) IST15002F12 (tigm) IST13200B5 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695304 (Chr19:7415658..7416334 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AACCTCGGTCTTCGGAATCT Chr19:7416262..7416281 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695304 (Chr19:7415658..7416334 -)
Downstram Exon
ENSMUSE00000695218 (Chr19:7369528..7369927 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AACCTCGGTCTTCGGAATCT Chr19:7416262..7416281 60.07 50 AGGACTACCAGCGACTTCCA Chr19:7369525..7369544 59.87 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695304 Chr19:7415658..7416334 AACCTCGGTCTTCGGAATCT Chr19:7416262..7416281 60.07 50

*** Putative Vector Insertion (Chr 19: 7369928 - 7415657) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000695218 Chr19:7369528..7369927 AGGACTACCAGCGACTTCCA Chr19:7369525..7369544 59.87 55
downstream ENSMUSE00000695217 Chr19:7365093..7365272 AGCCGGTAGTTGCCAATATG Chr19:7365141..7365160 59.98 50
downstream ENSMUSE00000695301 Chr19:7365093..7365272 AGCCGGTAGTTGCCAATATG Chr19:7365141..7365160 59.98 50
downstream ENSMUSE00000146730 Chr19:7364806..7364859 AGCTGGGTCTTGTCGATGAT Chr19:7364806..7364825 59.69 50
downstream ENSMUSE00000146723 Chr19:7361820..7361868 TGGGATGATTCAAAACCTTCA Chr19:7361804..7361824 60.29 38.1
downstream ENSMUSE00000146738 Chr19:7361491..7361556 CCACTGGCATACTCCATGAC Chr19:7361471..7361490 58.96 55
downstream ENSMUSE00000146735 Chr19:7361324..7361394 TTGGCTCGAGCTTCTTTTTC Chr19:7361312..7361331 59.71 45
downstream ENSMUSE00000146737 Chr19:7361059..7361115 TGACAGTACTGCACAGCAGACA Chr19:7361068..7361089 60.72 50
downstream ENSMUSE00000146736 Chr19:7360222..7360458 CCAAAGGTGAATTCGTTGCT Chr19:7360360..7360379 60.11 45
downstream ENSMUSE00000146729 Chr19:7359359..7359478 TACGGTATTTCCCCCTCAGT Chr19:7359420..7359439 58.38 50
downstream ENSMUSE00000695224 Chr19:7359177..7359249 CACGTTCATCCACCGATCTT Chr19:7359198..7359217 60.92 50
downstream ENSMUSE00000146726 Chr19:7359150..7359249 CACGTTCATCCACCGATCTT Chr19:7359198..7359217 60.92 50
downstream ENSMUSE00000486614 Chr19:7359043..7359089 CCCATTGACACCATCAACTC Chr19:7359027..7359046 58.77 50
downstream ENSMUSE00000550698 Chr19:7358955..7359067 CTGGATCTCTTCCCGTGTGT Chr19:7359005..7359024 60.11 55
downstream ENSMUSE00000550711 Chr19:7358955..7359038 CGTTGTACCTCTGGCCTACC Chr19:7358977..7358996 59.62 60
downstream ENSMUSE00000550710 Chr19:7357926..7358058 GGGGCTTCAAAGTGATGGTA Chr19:7358006..7358025 59.93 50
downstream ENSMUSE00000550709 Chr19:7357523..7357695 CCGCTTATTTTCTGCGTTGT Chr19:7357603..7357622 60.26 45
downstream ENSMUSE00000550708 Chr19:7357216..7357313 AAAAGTGGGGAGTTCCTGCT Chr19:7357242..7357261 60.11 50
downstream ENSMUSE00000550707 Chr19:7356288..7356449 CCGAGGCACCTCACAGTTAC Chr19:7356271..7356290 60.71 60
downstream ENSMUSE00000550706 Chr19:7355488..7355745 AAGGTGCTTCGACTGGACAC Chr19:7355610..7355629 60.31 55
downstream ENSMUSE00000643494 Chr19:7354476..7354502 TCTGGCAAACCTGAAAGACA Chr19:7354456..7354475 59.42 45
downstream ENSMUSE00000550704 Chr19:7352532..7352576 TCTCCACTCGGTCTTTGCTT Chr19:7352517..7352536 59.99 50
downstream ENSMUSE00000550701 Chr19:7349886..7351940 GATCTCCCGCATCATCTCAT Chr19:7351783..7351802 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAGGTGCCAGGAGGACAAAG Chr19:7373681..7373701 60.25 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTATCACCGTGACTGGGAAAA Chr19:7373592..7373613 59.98 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CTGTCATAATCGCCTTGCAG Chr19:7374270..7374290 59.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ACGAAACTAGTGTGGTTGTCACG Chr19:7374282..7374305 61.4 47.83 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024969