Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI35371
Trapped Gene
Gmip (ENSMUSG00000036246)
Vector Insertion
Chr 8: 72335540 - 72337514
Public Clones IST13328E7 (tigm)
Private Clones not available
Severity of mutation (?) Insertion after 19% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000236385 (Chr8:72335432..72335539 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACAGTGGCCCAACAGAAG Chr8:72335505..72335524 60.3 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000236385 (Chr8:72335432..72335539 +)
Downstram Exon
ENSMUSE00000236377 (Chr8:72337515..72337595 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACAGTGGCCCAACAGAAG Chr8:72335505..72335524 60.3 55 TCCTTCAGCCACTGTTCCTT Chr8:72337585..72337604 59.84 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000426879 Chr8:72332586..72332719 CCTGTCCCTTTCTCAGCATT Chr8:72332639..72332658 59.28 50
upstream ENSMUSE00000236430 Chr8:72333673..72333757 CGAGATATCATTGGGGAACG Chr8:72333737..72333756 60.29 50
upstream ENSMUSE00000236417 Chr8:72334529..72334616 CCCTGTACGCAGAGAAGACC Chr8:72334553..72334572 59.87 60
upstream ENSMUSE00000236410 Chr8:72334701..72334758 CAGTAGTTGGCGGGATCTCT Chr8:72334712..72334731 59.31 55
upstream ENSMUSE00000236400 Chr8:72335057..72335182 ACCAAGGGTGGTGTAGATGC Chr8:72335086..72335105 59.85 55
upstream ENSMUSE00000236393 Chr8:72335267..72335331 AAGGTGTCCATTCTCCAGCA Chr8:72335311..72335330 60.66 50
upstream ENSMUSE00000236385 Chr8:72335432..72335539 AGACAGTGGCCCAACAGAAG Chr8:72335505..72335524 60.3 55

*** Putative Vector Insertion (Chr 8: 72335540 - 72337514) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000236377 Chr8:72337515..72337595 TCCTTCAGCCACTGTTCCTT Chr8:72337585..72337604 59.84 50
downstream ENSMUSE00000236371 Chr8:72337681..72337851 GGTCCTCTCTGCGTTGAATG Chr8:72337744..72337763 60.8 55
downstream ENSMUSE00000236362 Chr8:72337937..72338074 TGCGCACATGTGACACTATC Chr8:72338042..72338061 59.28 50
downstream ENSMUSE00000236354 Chr8:72338294..72338490 TGCAGTGTCCGAACAAACTC Chr8:72338427..72338446 59.88 50
downstream ENSMUSE00000236346 Chr8:72339333..72339442 GTAGAGGCCCCGAAAACTTC Chr8:72339376..72339395 60.07 55
downstream ENSMUSE00000236336 Chr8:72339513..72339590 TGGAAGTGGGAGAATCCAAA Chr8:72339587..72339606 60.43 45
downstream ENSMUSE00000236327 Chr8:72339950..72340027 AGGGTCTCGCTCCTCAAAGT Chr8:72340029..72340048 60.39 55
downstream ENSMUSE00000236316 Chr8:72340108..72340262 CAGTGTCCACTTCCTGAACG Chr8:72340166..72340185 59.31 55
downstream ENSMUSE00000236307 Chr8:72340636..72340824 CACAAAGGGAACCTCCTCAG Chr8:72340779..72340798 59.69 55
downstream ENSMUSE00000236292 Chr8:72340902..72341039 GAACGCTGGTGATATCGTGA Chr8:72341022..72341041 59.68 50
downstream ENSMUSE00000236287 Chr8:72341132..72341328 GGGTCTTTGCCAGAGAGATG Chr8:72341195..72341214 59.8 55
downstream ENSMUSE00000236279 Chr8:72341622..72342009 TGGAATCCAAGGCTATGGTC Chr8:72341953..72341972 59.89 50
downstream ENSMUSE00000236272 Chr8:72344333..72344399 TCTGGTGTCTTCCACCTCCT Chr8:72344386..72344405 59.68 55
downstream ENSMUSE00000512339 Chr8:72344496..72345768 CCAAACCTCGTACCCTCAAA Chr8:72344705..72344724 59.96 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCCCAACAGAAGAGAGAC Chr8:72335512..72335532 60.39 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCCCAACAGAAGAGAGAC Chr8:72335512..72335532 60.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036246